Incidental Mutation 'R5431:Lhx3'
ID428031
Institutional Source Beutler Lab
Gene Symbol Lhx3
Ensembl Gene ENSMUSG00000026934
Gene NameLIM homeobox protein 3
SynonymsmLim-3, Lim3, P-LIM
MMRRC Submission 042847-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5431 (G1)
Quality Score193
Status Not validated
Chromosome2
Chromosomal Location26200212-26208289 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 26201118 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 395 (D395G)
Ref Sequence ENSEMBL: ENSMUSP00000028302 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028302] [ENSMUST00000054099]
PDB Structure
NMR Solution Structure of a ldb1-LID:Lhx3-LIM complex [SOLUTION NMR]
Crystal Structure of Lhx3 LIM domains 1 and 2 with the binding domain of Isl1 [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000028302
AA Change: D395G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000028302
Gene: ENSMUSG00000026934
AA Change: D395G

DomainStartEndE-ValueType
low complexity region 14 31 N/A INTRINSIC
LIM 35 86 4.18e-17 SMART
LIM 94 149 7.8e-17 SMART
HOX 162 224 7.13e-23 SMART
low complexity region 237 249 N/A INTRINSIC
low complexity region 323 342 N/A INTRINSIC
low complexity region 353 362 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000054099
AA Change: D393G

PolyPhen 2 Score 0.635 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000056822
Gene: ENSMUSG00000026934
AA Change: D393G

DomainStartEndE-ValueType
LIM 33 84 4.18e-17 SMART
LIM 92 147 7.8e-17 SMART
HOX 160 222 7.13e-23 SMART
low complexity region 235 247 N/A INTRINSIC
low complexity region 321 340 N/A INTRINSIC
low complexity region 351 360 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127035
SMART Domains Protein: ENSMUSP00000134884
Gene: ENSMUSG00000026934

DomainStartEndE-ValueType
Pfam:Homeobox 1 17 6.2e-5 PFAM
low complexity region 35 47 N/A INTRINSIC
low complexity region 121 140 N/A INTRINSIC
low complexity region 151 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149637
SMART Domains Protein: ENSMUSP00000135765
Gene: ENSMUSG00000026934

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 22 38 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a large family of proteins which carry the LIM domain, a unique cysteine-rich zinc-binding domain. The encoded protein is a transcription factor that is required for pituitary development and motor neuron specification. Mutations in this gene cause combined pituitary hormone deficiency 3. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Dec 2015]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit failure of growth and differentiation of Rathke's pouch, lack both anterior and intermediate lobes of the pituitary gland, and die perinatally, within 24 hours of birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,538 S124G possibly damaging Het
4921539E11Rik T C 4: 103,270,848 T27A probably benign Het
Aspg T A 12: 112,123,412 N461K probably benign Het
B4galnt3 T A 6: 120,218,967 T300S probably damaging Het
BC035044 A G 6: 128,885,007 probably benign Het
Bmp5 C T 9: 75,893,709 P374S probably damaging Het
C330018D20Rik A T 18: 56,957,856 F78L probably benign Het
Cds2 T A 2: 132,302,170 S289T probably benign Het
Cerkl C T 2: 79,341,335 C393Y probably damaging Het
Ciita C T 16: 10,523,792 R1020C probably damaging Het
Dcaf13 C A 15: 39,123,224 D130E probably benign Het
Dnal4 C T 15: 79,762,447 G50R probably damaging Het
Elfn1 A G 5: 139,971,568 N109S probably damaging Het
Ep400 A G 5: 110,676,554 V2435A unknown Het
Fam178b T C 1: 36,632,485 E185G probably damaging Het
Fam227b C A 2: 126,126,931 L74F probably benign Het
Fam92b C A 8: 120,167,303 probably null Het
Fgfr4 G A 13: 55,156,651 V138I probably benign Het
Flnc A G 6: 29,456,384 I2161V possibly damaging Het
Frmd5 T C 2: 121,562,909 N235S probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ggt6 A G 11: 72,437,738 T355A possibly damaging Het
Gm14393 G A 2: 175,063,876 T41I probably damaging Het
Gpr151 A C 18: 42,578,867 S249A probably damaging Het
Gpr152 T A 19: 4,143,747 V429D probably benign Het
Grm7 G A 6: 111,358,426 M599I probably benign Het
Hdac4 T A 1: 91,972,790 R54* probably null Het
Ice1 A G 13: 70,592,650 L2146S probably damaging Het
Igfbpl1 C T 4: 45,815,588 V183I probably benign Het
Kel G A 6: 41,698,420 S299F probably benign Het
Kif14 T C 1: 136,496,695 I1016T possibly damaging Het
Micu1 T C 10: 59,750,521 Y140H possibly damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nbn C T 4: 15,986,593 H665Y probably benign Het
Pkhd1 G T 1: 20,117,836 T3416K probably benign Het
Plxnb1 T C 9: 109,100,772 F232S probably damaging Het
Pus7l T C 15: 94,529,486 N472D probably damaging Het
Rfx1 C T 8: 84,082,720 Q225* probably null Het
Rnase2a T C 14: 51,255,563 Y115C possibly damaging Het
Ryr1 T A 7: 29,109,812 D386V probably benign Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Sgcz T A 8: 37,639,984 T125S probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Syt2 A G 1: 134,740,957 S36G probably benign Het
Tcaf3 A G 6: 42,597,185 L31P probably damaging Het
Tenm3 C A 8: 48,367,377 E142* probably null Het
Tgfbr2 G T 9: 116,131,601 S94R probably damaging Het
Vmn2r12 A G 5: 109,091,818 I293T probably damaging Het
Wrap73 G A 4: 154,145,274 R34Q probably damaging Het
Zc3h14 A G 12: 98,780,065 D511G possibly damaging Het
Zcchc11 T A 4: 108,491,412 I297N probably damaging Het
Other mutations in Lhx3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02309:Lhx3 APN 2 26201373 missense probably benign
IGL02691:Lhx3 APN 2 26203085 missense probably damaging 1.00
R0267:Lhx3 UTSW 2 26203028 missense probably benign 0.02
R0571:Lhx3 UTSW 2 26201124 missense probably damaging 1.00
R0574:Lhx3 UTSW 2 26201311 missense probably benign 0.00
R1866:Lhx3 UTSW 2 26203974 missense probably damaging 0.99
R1926:Lhx3 UTSW 2 26202188 nonsense probably null
R1940:Lhx3 UTSW 2 26203962 missense probably benign 0.05
R3147:Lhx3 UTSW 2 26201265 missense probably benign 0.01
R4389:Lhx3 UTSW 2 26201090 utr 3 prime probably benign
R4534:Lhx3 UTSW 2 26204014 missense probably benign
R4551:Lhx3 UTSW 2 26201190 missense probably damaging 1.00
R4761:Lhx3 UTSW 2 26201423 frame shift probably null
R5102:Lhx3 UTSW 2 26201423 frame shift probably null
R5105:Lhx3 UTSW 2 26201423 frame shift probably null
R5673:Lhx3 UTSW 2 26202994 missense probably damaging 1.00
R5751:Lhx3 UTSW 2 26201161 missense probably benign
R6180:Lhx3 UTSW 2 26201491 missense probably benign
R6262:Lhx3 UTSW 2 26202423 small deletion probably benign
R7238:Lhx3 UTSW 2 26202997 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGAAATGGTCACTGGCTTG -3'
(R):5'- AGAGCAGTACCGAGAGCTAC -3'

Sequencing Primer
(F):5'- GACTTTGGAGTCCCTCAGC -3'
(R):5'- TACCGAGAGCTACGCCCAG -3'
Posted On2016-09-01