Incidental Mutation 'R5431:Frmd5'
ID428033
Institutional Source Beutler Lab
Gene Symbol Frmd5
Ensembl Gene ENSMUSG00000027238
Gene NameFERM domain containing 5
SynonymsA930004K21Rik, 1500032A09Rik
MMRRC Submission 042847-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.414) question?
Stock #R5431 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location121545529-121807087 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 121562909 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Serine at position 235 (N235S)
Ref Sequence ENSEMBL: ENSMUSP00000115136 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000110592] [ENSMUST00000110593] [ENSMUST00000121219] [ENSMUST00000128428] [ENSMUST00000138157] [ENSMUST00000155570]
Predicted Effect probably damaging
Transcript: ENSMUST00000110592
AA Change: N235S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106222
Gene: ENSMUSG00000027238
AA Change: N235S

DomainStartEndE-ValueType
B41 13 210 2.23e-61 SMART
FERM_C 214 302 6.86e-24 SMART
FA 308 354 1.45e-13 SMART
low complexity region 452 474 N/A INTRINSIC
transmembrane domain 501 523 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000110593
AA Change: N227S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000106223
Gene: ENSMUSG00000027238
AA Change: N227S

DomainStartEndE-ValueType
B41 2 202 4.13e-56 SMART
FERM_C 206 294 6.86e-24 SMART
FA 300 346 1.45e-13 SMART
low complexity region 444 466 N/A INTRINSIC
low complexity region 489 504 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121219
AA Change: N146S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000113568
Gene: ENSMUSG00000027238
AA Change: N146S

DomainStartEndE-ValueType
B41 1 121 1.92e-4 SMART
FERM_C 125 213 6.86e-24 SMART
FA 219 265 1.45e-13 SMART
low complexity region 363 385 N/A INTRINSIC
transmembrane domain 412 434 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000128428
AA Change: T206A
SMART Domains Protein: ENSMUSP00000116468
Gene: ENSMUSG00000027238
AA Change: T206A

DomainStartEndE-ValueType
B41 13 202 3.21e-44 SMART
Predicted Effect unknown
Transcript: ENSMUST00000133898
AA Change: N153S
SMART Domains Protein: ENSMUSP00000118269
Gene: ENSMUSG00000027238
AA Change: N153S

DomainStartEndE-ValueType
B41 1 129 8.68e-9 SMART
FERM_C 133 221 6.86e-24 SMART
FA 227 273 1.45e-13 SMART
low complexity region 371 393 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000138157
AA Change: N235S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115136
Gene: ENSMUSG00000027238
AA Change: N235S

DomainStartEndE-ValueType
B41 13 210 2.23e-61 SMART
FERM_C 214 302 6.86e-24 SMART
FA 308 354 1.45e-13 SMART
low complexity region 452 474 N/A INTRINSIC
low complexity region 497 512 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153932
Predicted Effect probably damaging
Transcript: ENSMUST00000155570
AA Change: N227S

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120176
Gene: ENSMUSG00000027238
AA Change: N227S

DomainStartEndE-ValueType
B41 2 202 4.13e-56 SMART
FERM_C 206 294 6.86e-24 SMART
FA 300 346 1.45e-13 SMART
low complexity region 444 466 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,538 S124G possibly damaging Het
4921539E11Rik T C 4: 103,270,848 T27A probably benign Het
Aspg T A 12: 112,123,412 N461K probably benign Het
B4galnt3 T A 6: 120,218,967 T300S probably damaging Het
BC035044 A G 6: 128,885,007 probably benign Het
Bmp5 C T 9: 75,893,709 P374S probably damaging Het
C330018D20Rik A T 18: 56,957,856 F78L probably benign Het
Cds2 T A 2: 132,302,170 S289T probably benign Het
Cerkl C T 2: 79,341,335 C393Y probably damaging Het
Ciita C T 16: 10,523,792 R1020C probably damaging Het
Dcaf13 C A 15: 39,123,224 D130E probably benign Het
Dnal4 C T 15: 79,762,447 G50R probably damaging Het
Elfn1 A G 5: 139,971,568 N109S probably damaging Het
Ep400 A G 5: 110,676,554 V2435A unknown Het
Fam178b T C 1: 36,632,485 E185G probably damaging Het
Fam227b C A 2: 126,126,931 L74F probably benign Het
Fam92b C A 8: 120,167,303 probably null Het
Fgfr4 G A 13: 55,156,651 V138I probably benign Het
Flnc A G 6: 29,456,384 I2161V possibly damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ggt6 A G 11: 72,437,738 T355A possibly damaging Het
Gm14393 G A 2: 175,063,876 T41I probably damaging Het
Gpr151 A C 18: 42,578,867 S249A probably damaging Het
Gpr152 T A 19: 4,143,747 V429D probably benign Het
Grm7 G A 6: 111,358,426 M599I probably benign Het
Hdac4 T A 1: 91,972,790 R54* probably null Het
Ice1 A G 13: 70,592,650 L2146S probably damaging Het
Igfbpl1 C T 4: 45,815,588 V183I probably benign Het
Kel G A 6: 41,698,420 S299F probably benign Het
Kif14 T C 1: 136,496,695 I1016T possibly damaging Het
Lhx3 T C 2: 26,201,118 D395G probably damaging Het
Micu1 T C 10: 59,750,521 Y140H possibly damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nbn C T 4: 15,986,593 H665Y probably benign Het
Pkhd1 G T 1: 20,117,836 T3416K probably benign Het
Plxnb1 T C 9: 109,100,772 F232S probably damaging Het
Pus7l T C 15: 94,529,486 N472D probably damaging Het
Rfx1 C T 8: 84,082,720 Q225* probably null Het
Rnase2a T C 14: 51,255,563 Y115C possibly damaging Het
Ryr1 T A 7: 29,109,812 D386V probably benign Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Sgcz T A 8: 37,639,984 T125S probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Syt2 A G 1: 134,740,957 S36G probably benign Het
Tcaf3 A G 6: 42,597,185 L31P probably damaging Het
Tenm3 C A 8: 48,367,377 E142* probably null Het
Tgfbr2 G T 9: 116,131,601 S94R probably damaging Het
Vmn2r12 A G 5: 109,091,818 I293T probably damaging Het
Wrap73 G A 4: 154,145,274 R34Q probably damaging Het
Zc3h14 A G 12: 98,780,065 D511G possibly damaging Het
Zcchc11 T A 4: 108,491,412 I297N probably damaging Het
Other mutations in Frmd5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL03025:Frmd5 APN 2 121553344 missense probably benign
big_rip UTSW 2 121549218 nonsense probably null
PIT4812001:Frmd5 UTSW 2 121586446 missense probably benign 0.34
R0385:Frmd5 UTSW 2 121555574 missense probably damaging 1.00
R1667:Frmd5 UTSW 2 121548730 frame shift probably null
R4243:Frmd5 UTSW 2 121562882 splice site probably null
R4590:Frmd5 UTSW 2 121765031 splice site probably null
R4705:Frmd5 UTSW 2 121562863 intron probably benign
R4909:Frmd5 UTSW 2 121591653 splice site probably null
R4935:Frmd5 UTSW 2 121562924 missense possibly damaging 0.75
R5008:Frmd5 UTSW 2 121548860 missense probably damaging 1.00
R5095:Frmd5 UTSW 2 121548921 missense possibly damaging 0.95
R5875:Frmd5 UTSW 2 121558478 intron probably benign
R6246:Frmd5 UTSW 2 121551048 missense possibly damaging 0.66
R6404:Frmd5 UTSW 2 121549218 nonsense probably null
R7039:Frmd5 UTSW 2 121547647 unclassified probably benign
R7072:Frmd5 UTSW 2 121557870 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TGTTGACTCTCAGGGACACC -3'
(R):5'- GCCTACAAATAGCATGGGTGTC -3'

Sequencing Primer
(F):5'- GGAAGACCACTACCTTCATCAG -3'
(R):5'- CCCTTGAACTCACTATGTAGCTGAAG -3'
Posted On2016-09-01