Incidental Mutation 'R5431:Tgfbr2'
ID428057
Institutional Source Beutler Lab
Gene Symbol Tgfbr2
Ensembl Gene ENSMUSG00000032440
Gene Nametransforming growth factor, beta receptor II
SynonymsTbetaR-II, TBR-II, TbetaRII, 1110020H15Rik
MMRRC Submission 042847-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5431 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location116084293-116175360 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 116131601 bp
ZygosityHeterozygous
Amino Acid Change Serine to Arginine at position 94 (S94R)
Ref Sequence ENSEMBL: ENSMUSP00000062333 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000035014] [ENSMUST00000061101]
Predicted Effect probably damaging
Transcript: ENSMUST00000035014
AA Change: S69R

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035014
Gene: ENSMUSG00000032440
AA Change: S69R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ecTbetaR2 47 165 1.8e-55 PFAM
Pfam:Pkinase 244 538 9.9e-52 PFAM
Pfam:Pkinase_Tyr 244 538 2.9e-37 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000061101
AA Change: S94R

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000062333
Gene: ENSMUSG00000032440
AA Change: S94R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ecTbetaR2 74 184 4.6e-45 PFAM
transmembrane domain 189 211 N/A INTRINSIC
Pfam:Pkinase 269 563 2.7e-36 PFAM
Pfam:Pkinase_Tyr 269 563 5e-37 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the Ser/Thr protein kinase family and the TGFB receptor subfamily. The encoded protein is a transmembrane protein that has a protein kinase domain, forms a heterodimeric complex with another receptor protein, and binds TGF-beta. This receptor/ligand complex phosphorylates proteins, which then enter the nucleus and regulate the transcription of a subset of genes related to cell proliferation. Mutations in this gene have been associated with Marfan Syndrome, Loeys-Deitz Aortic Aneurysm Syndrome, and the development of various types of tumors. Alternatively spliced transcript variants encoding different isoforms have been characterized. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die in midgestation with impaired yolk sac hematopoiesis and vasculogenesis. Selective knockouts in bone marrow cells and cranial neural crest show inflammation and cleft palate/calvarial defects, respectively. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,538 S124G possibly damaging Het
4921539E11Rik T C 4: 103,270,848 T27A probably benign Het
Aspg T A 12: 112,123,412 N461K probably benign Het
B4galnt3 T A 6: 120,218,967 T300S probably damaging Het
BC035044 A G 6: 128,885,007 probably benign Het
Bmp5 C T 9: 75,893,709 P374S probably damaging Het
C330018D20Rik A T 18: 56,957,856 F78L probably benign Het
Cds2 T A 2: 132,302,170 S289T probably benign Het
Cerkl C T 2: 79,341,335 C393Y probably damaging Het
Ciita C T 16: 10,523,792 R1020C probably damaging Het
Dcaf13 C A 15: 39,123,224 D130E probably benign Het
Dnal4 C T 15: 79,762,447 G50R probably damaging Het
Elfn1 A G 5: 139,971,568 N109S probably damaging Het
Ep400 A G 5: 110,676,554 V2435A unknown Het
Fam178b T C 1: 36,632,485 E185G probably damaging Het
Fam227b C A 2: 126,126,931 L74F probably benign Het
Fam92b C A 8: 120,167,303 probably null Het
Fgfr4 G A 13: 55,156,651 V138I probably benign Het
Flnc A G 6: 29,456,384 I2161V possibly damaging Het
Frmd5 T C 2: 121,562,909 N235S probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ggt6 A G 11: 72,437,738 T355A possibly damaging Het
Gm14393 G A 2: 175,063,876 T41I probably damaging Het
Gpr151 A C 18: 42,578,867 S249A probably damaging Het
Gpr152 T A 19: 4,143,747 V429D probably benign Het
Grm7 G A 6: 111,358,426 M599I probably benign Het
Hdac4 T A 1: 91,972,790 R54* probably null Het
Ice1 A G 13: 70,592,650 L2146S probably damaging Het
Igfbpl1 C T 4: 45,815,588 V183I probably benign Het
Kel G A 6: 41,698,420 S299F probably benign Het
Kif14 T C 1: 136,496,695 I1016T possibly damaging Het
Lhx3 T C 2: 26,201,118 D395G probably damaging Het
Micu1 T C 10: 59,750,521 Y140H possibly damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nbn C T 4: 15,986,593 H665Y probably benign Het
Pkhd1 G T 1: 20,117,836 T3416K probably benign Het
Plxnb1 T C 9: 109,100,772 F232S probably damaging Het
Pus7l T C 15: 94,529,486 N472D probably damaging Het
Rfx1 C T 8: 84,082,720 Q225* probably null Het
Rnase2a T C 14: 51,255,563 Y115C possibly damaging Het
Ryr1 T A 7: 29,109,812 D386V probably benign Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Sgcz T A 8: 37,639,984 T125S probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Syt2 A G 1: 134,740,957 S36G probably benign Het
Tcaf3 A G 6: 42,597,185 L31P probably damaging Het
Tenm3 C A 8: 48,367,377 E142* probably null Het
Vmn2r12 A G 5: 109,091,818 I293T probably damaging Het
Wrap73 G A 4: 154,145,274 R34Q probably damaging Het
Zc3h14 A G 12: 98,780,065 D511G possibly damaging Het
Zcchc11 T A 4: 108,491,412 I297N probably damaging Het
Other mutations in Tgfbr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:Tgfbr2 APN 9 116110189 missense probably damaging 0.99
IGL00484:Tgfbr2 APN 9 116158289 missense probably benign 0.00
IGL01010:Tgfbr2 APN 9 116129980 missense possibly damaging 0.80
IGL01656:Tgfbr2 APN 9 116109669 missense probably damaging 1.00
IGL02496:Tgfbr2 APN 9 116090418 missense probably benign 0.13
IGL02550:Tgfbr2 APN 9 116110129 missense probably benign
IGL02563:Tgfbr2 APN 9 116129998 missense probably benign 0.10
IGL03403:Tgfbr2 APN 9 116110302 missense probably benign
IGL02799:Tgfbr2 UTSW 9 116110136 missense possibly damaging 0.50
R0617:Tgfbr2 UTSW 9 116158320 missense probably benign 0.00
R1483:Tgfbr2 UTSW 9 116109557 missense probably benign 0.04
R1776:Tgfbr2 UTSW 9 116174967 missense possibly damaging 0.94
R1777:Tgfbr2 UTSW 9 116109880 missense probably damaging 0.99
R1831:Tgfbr2 UTSW 9 116090536 missense possibly damaging 0.74
R2323:Tgfbr2 UTSW 9 116110144 missense possibly damaging 0.90
R2378:Tgfbr2 UTSW 9 116129950 missense probably benign 0.02
R3123:Tgfbr2 UTSW 9 116110069 missense possibly damaging 0.95
R3418:Tgfbr2 UTSW 9 116129833 missense probably damaging 1.00
R3605:Tgfbr2 UTSW 9 116109892 missense probably benign 0.03
R4039:Tgfbr2 UTSW 9 116175037 start codon destroyed probably null 0.62
R4191:Tgfbr2 UTSW 9 116109941 missense probably damaging 1.00
R4193:Tgfbr2 UTSW 9 116109941 missense probably damaging 1.00
R4945:Tgfbr2 UTSW 9 116131565 missense probably benign
R5714:Tgfbr2 UTSW 9 116175024 missense probably damaging 0.98
R5964:Tgfbr2 UTSW 9 116110255 missense possibly damaging 0.64
R6180:Tgfbr2 UTSW 9 116110144 missense possibly damaging 0.90
R6970:Tgfbr2 UTSW 9 116110051 missense probably damaging 0.97
R7228:Tgfbr2 UTSW 9 116109943 missense probably damaging 1.00
R7258:Tgfbr2 UTSW 9 116129830 missense probably damaging 0.98
R7315:Tgfbr2 UTSW 9 116109738 missense possibly damaging 0.49
Predicted Primers PCR Primer
(F):5'- TATGTGATACACGGGACTGTG -3'
(R):5'- TTTCTAGCACGGGATCCCATG -3'

Sequencing Primer
(F):5'- TAGACTGTGTCCCCCTAGAACTGG -3'
(R):5'- ATCCCATGGAGTAACCTCTGG -3'
Posted On2016-09-01