Incidental Mutation 'R5431:Gpr151'
ID428074
Institutional Source Beutler Lab
Gene Symbol Gpr151
Ensembl Gene ENSMUSG00000042816
Gene NameG protein-coupled receptor 151
SynonymsPGR7, C130082O03Rik, GalRL
MMRRC Submission 042847-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5431 (G1)
Quality Score225
Status Not validated
Chromosome18
Chromosomal Location42578020-42579652 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 42578867 bp
ZygosityHeterozygous
Amino Acid Change Serine to Alanine at position 249 (S249A)
Ref Sequence ENSEMBL: ENSMUSP00000058887 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025375] [ENSMUST00000054738] [ENSMUST00000173642]
Predicted Effect probably benign
Transcript: ENSMUST00000025375
SMART Domains Protein: ENSMUSP00000025375
Gene: ENSMUSG00000024498

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 40 92 N/A INTRINSIC
WW 132 164 8.27e-10 SMART
low complexity region 178 257 N/A INTRINSIC
low complexity region 260 347 N/A INTRINSIC
low complexity region 350 373 N/A INTRINSIC
WW 432 464 2.65e-8 SMART
WW 531 563 1.2e-6 SMART
low complexity region 611 623 N/A INTRINSIC
coiled coil region 629 654 N/A INTRINSIC
FF 661 714 2.67e-13 SMART
FF 727 781 1.51e-12 SMART
FF 794 848 4.29e-17 SMART
FF 898 954 8.33e-15 SMART
FF 956 1012 1.47e-15 SMART
FF 1014 1079 1.3e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000054738
AA Change: S249A

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000058887
Gene: ENSMUSG00000042816
AA Change: S249A

DomainStartEndE-ValueType
Pfam:7tm_1 57 310 1.6e-18 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000173642
SMART Domains Protein: ENSMUSP00000134458
Gene: ENSMUSG00000024498

DomainStartEndE-ValueType
low complexity region 3 13 N/A INTRINSIC
low complexity region 40 92 N/A INTRINSIC
WW 132 164 8.27e-10 SMART
low complexity region 178 257 N/A INTRINSIC
low complexity region 260 347 N/A INTRINSIC
low complexity region 350 373 N/A INTRINSIC
WW 432 464 2.65e-8 SMART
WW 531 563 1.2e-6 SMART
low complexity region 611 623 N/A INTRINSIC
coiled coil region 629 654 N/A INTRINSIC
FF 661 714 2.67e-13 SMART
FF 727 781 1.51e-12 SMART
FF 794 848 4.29e-17 SMART
FF 898 954 8.33e-15 SMART
FF 956 1012 1.47e-15 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184771
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to the galanin receptor subfamily of G protein-coupled receptors. The encoded protein is found predominantly in the central nervous system. [provided by RefSeq, Feb 2017]
PHENOTYPE: Homozygous mutation of this gene does not appear to result in a phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310061N02Rik T C 16: 88,707,538 S124G possibly damaging Het
4921539E11Rik T C 4: 103,270,848 T27A probably benign Het
Aspg T A 12: 112,123,412 N461K probably benign Het
B4galnt3 T A 6: 120,218,967 T300S probably damaging Het
BC035044 A G 6: 128,885,007 probably benign Het
Bmp5 C T 9: 75,893,709 P374S probably damaging Het
C330018D20Rik A T 18: 56,957,856 F78L probably benign Het
Cds2 T A 2: 132,302,170 S289T probably benign Het
Cerkl C T 2: 79,341,335 C393Y probably damaging Het
Ciita C T 16: 10,523,792 R1020C probably damaging Het
Dcaf13 C A 15: 39,123,224 D130E probably benign Het
Dnal4 C T 15: 79,762,447 G50R probably damaging Het
Elfn1 A G 5: 139,971,568 N109S probably damaging Het
Ep400 A G 5: 110,676,554 V2435A unknown Het
Fam178b T C 1: 36,632,485 E185G probably damaging Het
Fam227b C A 2: 126,126,931 L74F probably benign Het
Fam92b C A 8: 120,167,303 probably null Het
Fgfr4 G A 13: 55,156,651 V138I probably benign Het
Flnc A G 6: 29,456,384 I2161V possibly damaging Het
Frmd5 T C 2: 121,562,909 N235S probably damaging Het
Gad1-ps G A 10: 99,445,147 noncoding transcript Het
Ggt6 A G 11: 72,437,738 T355A possibly damaging Het
Gm14393 G A 2: 175,063,876 T41I probably damaging Het
Gpr152 T A 19: 4,143,747 V429D probably benign Het
Grm7 G A 6: 111,358,426 M599I probably benign Het
Hdac4 T A 1: 91,972,790 R54* probably null Het
Ice1 A G 13: 70,592,650 L2146S probably damaging Het
Igfbpl1 C T 4: 45,815,588 V183I probably benign Het
Kel G A 6: 41,698,420 S299F probably benign Het
Kif14 T C 1: 136,496,695 I1016T possibly damaging Het
Lhx3 T C 2: 26,201,118 D395G probably damaging Het
Micu1 T C 10: 59,750,521 Y140H possibly damaging Het
Myt1l G A 12: 29,832,332 G509R unknown Het
Nbn C T 4: 15,986,593 H665Y probably benign Het
Pkhd1 G T 1: 20,117,836 T3416K probably benign Het
Plxnb1 T C 9: 109,100,772 F232S probably damaging Het
Pus7l T C 15: 94,529,486 N472D probably damaging Het
Rfx1 C T 8: 84,082,720 Q225* probably null Het
Rnase2a T C 14: 51,255,563 Y115C possibly damaging Het
Ryr1 T A 7: 29,109,812 D386V probably benign Het
Sfi1 A ATCTTCCCAAAGCCAGTGC 11: 3,153,384 probably benign Homo
Sgcz T A 8: 37,639,984 T125S probably damaging Het
Sntb1 C G 15: 55,642,795 G461R probably damaging Het
Syt2 A G 1: 134,740,957 S36G probably benign Het
Tcaf3 A G 6: 42,597,185 L31P probably damaging Het
Tenm3 C A 8: 48,367,377 E142* probably null Het
Tgfbr2 G T 9: 116,131,601 S94R probably damaging Het
Vmn2r12 A G 5: 109,091,818 I293T probably damaging Het
Wrap73 G A 4: 154,145,274 R34Q probably damaging Het
Zc3h14 A G 12: 98,780,065 D511G possibly damaging Het
Zcchc11 T A 4: 108,491,412 I297N probably damaging Het
Other mutations in Gpr151
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02631:Gpr151 APN 18 42578770 missense probably benign 0.03
IGL03167:Gpr151 APN 18 42578374 missense probably benign 0.06
R1561:Gpr151 UTSW 18 42579156 missense probably benign 0.42
R3875:Gpr151 UTSW 18 42578596 missense probably benign 0.02
R4294:Gpr151 UTSW 18 42578537 missense probably benign 0.00
R5188:Gpr151 UTSW 18 42578755 missense probably benign
R5815:Gpr151 UTSW 18 42579385 missense probably benign 0.00
R6199:Gpr151 UTSW 18 42578554 missense probably benign 0.31
R6302:Gpr151 UTSW 18 42579394 missense probably damaging 1.00
R6891:Gpr151 UTSW 18 42578920 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- ATAGGCCTTTCAAGCCTGCC -3'
(R):5'- AATGTGCCTCGTGGATGTGC -3'

Sequencing Primer
(F):5'- GCCTTGAACTCTTCAGACATAACTAG -3'
(R):5'- CCAGCTGTGGCAGAAGAATTC -3'
Posted On2016-09-01