Incidental Mutation 'R5432:Srgap1'
ID428105
Institutional Source Beutler Lab
Gene Symbol Srgap1
Ensembl Gene ENSMUSG00000020121
Gene NameSLIT-ROBO Rho GTPase activating protein 1
SynonymsArhgap13, 4930572H05Rik
MMRRC Submission 042997-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.262) question?
Stock #R5432 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location121780991-122047315 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 121869823 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 232 (N232I)
Ref Sequence ENSEMBL: ENSMUSP00000080389 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020322] [ENSMUST00000081688]
Predicted Effect probably damaging
Transcript: ENSMUST00000020322
AA Change: N232I

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000020322
Gene: ENSMUSG00000020121
AA Change: N232I

DomainStartEndE-ValueType
FCH 22 121 3.81e-16 SMART
low complexity region 173 193 N/A INTRINSIC
coiled coil region 352 382 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
RhoGAP 494 668 1.27e-64 SMART
SH3 723 778 1.57e-14 SMART
low complexity region 826 840 N/A INTRINSIC
low complexity region 1004 1014 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000081688
AA Change: N232I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000080389
Gene: ENSMUSG00000020121
AA Change: N232I

DomainStartEndE-ValueType
FCH 22 121 3.81e-16 SMART
low complexity region 173 193 N/A INTRINSIC
coiled coil region 352 382 N/A INTRINSIC
low complexity region 405 418 N/A INTRINSIC
RhoGAP 517 691 1.27e-64 SMART
SH3 746 801 1.57e-14 SMART
low complexity region 849 863 N/A INTRINSIC
low complexity region 1027 1037 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.5%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a GTPase activator, working with the GTPase CDC42 to negatively regulate neuronal migration. The encoded protein interacts with the transmembrane receptor ROBO1 to inactivate CDC42. [provided by RefSeq, Sep 2016]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aasdhppt G A 9: 4,309,349 R30* probably null Het
Abca9 G A 11: 110,141,554 R746W possibly damaging Het
Akap13 A G 7: 75,602,830 E236G probably damaging Het
Asb4 A C 6: 5,430,912 R382S probably damaging Het
Bahcc1 T C 11: 120,287,988 S2458P probably benign Het
Bspry T C 4: 62,482,715 V148A probably benign Het
Cacna2d3 A C 14: 28,943,555 probably null Het
Cblb T A 16: 52,142,865 H390Q probably damaging Het
Cct8l1 T C 5: 25,516,307 S7P possibly damaging Het
Cep295 T C 9: 15,351,695 T191A possibly damaging Het
Cts8 A C 13: 61,251,012 F227V probably benign Het
Elac1 T C 18: 73,742,793 T56A possibly damaging Het
Fjx1 T C 2: 102,450,519 N357S possibly damaging Het
Gm14139 A G 2: 150,191,981 N74S possibly damaging Het
Gm340 A G 19: 41,584,603 E599G probably damaging Het
Gm5414 T C 15: 101,624,634 T453A probably damaging Het
Hcls1 G A 16: 36,961,548 E340K probably benign Het
Hrc C A 7: 45,336,861 H479N possibly damaging Het
Ikzf4 A G 10: 128,634,178 V491A probably damaging Het
Kalrn A G 16: 34,053,622 S138P probably damaging Het
Lama3 G T 18: 12,572,066 D3062Y probably damaging Het
Llgl1 T C 11: 60,707,623 S442P probably benign Het
Macf1 T A 4: 123,459,336 K1517* probably null Het
Myo9a A T 9: 59,865,670 Y995F possibly damaging Het
Nek3 A C 8: 22,148,732 probably null Het
Nynrin A G 14: 55,864,466 T531A possibly damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr164 A T 16: 19,286,089 I218N probably benign Het
Pdia4 A G 6: 47,798,466 V470A possibly damaging Het
Pinlyp T C 7: 24,542,467 D105G probably damaging Het
Pla2g6 A G 15: 79,302,617 probably null Het
Plpp7 A G 2: 32,095,920 S37G probably benign Het
Prdm11 G T 2: 92,975,813 P264Q probably benign Het
Rbl2 G T 8: 91,102,283 R604L probably benign Het
Rfx7 A G 9: 72,593,302 T115A probably benign Het
Samd4 A G 14: 47,074,062 Q279R probably benign Het
Sdha G T 13: 74,326,949 A591D probably damaging Het
Secisbp2 AAGCAGCAGCAGCAGCAGCA AAGCAGCAGCAGCAGCA 13: 51,673,966 probably benign Het
Sephs2 G A 7: 127,273,805 R39W probably damaging Het
Serpina3f T C 12: 104,220,318 I381T possibly damaging Het
Shd A T 17: 55,976,214 Q281L probably damaging Het
Sik3 A G 9: 46,123,241 S98G probably benign Het
Thbs1 A T 2: 118,114,683 N246Y probably benign Het
Usp9y A G Y: 1,368,022 probably null Het
Vwde A G 6: 13,190,592 M500T probably damaging Het
Wdr72 T G 9: 74,275,946 S1053R probably damaging Het
Yif1b T C 7: 29,245,968 C192R probably damaging Het
Zc3h13 A G 14: 75,331,247 S1327G probably damaging Het
Other mutations in Srgap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01964:Srgap1 APN 10 121804966 missense possibly damaging 0.81
IGL02106:Srgap1 APN 10 121785693 missense possibly damaging 0.95
IGL02927:Srgap1 APN 10 121855462 missense probably damaging 0.99
IGL03088:Srgap1 APN 10 121825693 missense possibly damaging 0.94
IGL03208:Srgap1 APN 10 121792266 missense possibly damaging 0.89
IGL03251:Srgap1 APN 10 121804921 unclassified probably null
PIT1430001:Srgap1 UTSW 10 121896753 splice site probably benign
R0052:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R0052:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R0356:Srgap1 UTSW 10 121855536 splice site probably null
R0361:Srgap1 UTSW 10 122047192 start codon destroyed probably null 0.89
R0365:Srgap1 UTSW 10 121785705 missense possibly damaging 0.80
R0675:Srgap1 UTSW 10 121792235 missense probably damaging 1.00
R0801:Srgap1 UTSW 10 121807875 missense probably damaging 0.96
R0815:Srgap1 UTSW 10 121785474 missense probably damaging 0.99
R1034:Srgap1 UTSW 10 121785445 missense possibly damaging 0.69
R1160:Srgap1 UTSW 10 121855477 missense probably benign 0.01
R1454:Srgap1 UTSW 10 121896738 missense probably damaging 0.99
R1624:Srgap1 UTSW 10 121855373 missense probably benign 0.03
R1628:Srgap1 UTSW 10 121870339 missense probably benign 0.15
R1816:Srgap1 UTSW 10 121925971 nonsense probably null
R1933:Srgap1 UTSW 10 121925903 missense possibly damaging 0.89
R2034:Srgap1 UTSW 10 121792746 missense probably damaging 0.98
R2211:Srgap1 UTSW 10 121853740 missense possibly damaging 0.55
R2295:Srgap1 UTSW 10 121794760 missense probably benign 0.03
R2368:Srgap1 UTSW 10 121829289 missense probably benign 0.05
R3796:Srgap1 UTSW 10 122047132 missense probably benign 0.06
R4083:Srgap1 UTSW 10 121785690 missense probably damaging 1.00
R4172:Srgap1 UTSW 10 121855363 missense probably benign 0.00
R4322:Srgap1 UTSW 10 121869806 missense probably damaging 1.00
R4401:Srgap1 UTSW 10 121804921 unclassified probably null
R4513:Srgap1 UTSW 10 121870326 critical splice donor site probably null
R4698:Srgap1 UTSW 10 121792487 missense probably benign 0.22
R4776:Srgap1 UTSW 10 121792351 missense probably benign 0.03
R4951:Srgap1 UTSW 10 121785552 missense probably benign 0.20
R5116:Srgap1 UTSW 10 121792379 missense possibly damaging 0.77
R5232:Srgap1 UTSW 10 121840911 missense probably benign 0.00
R5237:Srgap1 UTSW 10 121807883 missense probably damaging 1.00
R5335:Srgap1 UTSW 10 121785377 utr 3 prime probably benign
R5402:Srgap1 UTSW 10 121785760 missense probably benign 0.06
R5456:Srgap1 UTSW 10 121869811 missense probably benign 0.45
R5669:Srgap1 UTSW 10 121804850 missense probably benign 0.00
R5682:Srgap1 UTSW 10 121805014 missense probably damaging 1.00
R5687:Srgap1 UTSW 10 121825636 missense probably damaging 1.00
R5773:Srgap1 UTSW 10 121896709 missense probably benign 0.02
R5832:Srgap1 UTSW 10 121840914 missense probably damaging 1.00
R6028:Srgap1 UTSW 10 121828730 missense probably null
R6240:Srgap1 UTSW 10 122047156 missense probably benign 0.06
R6336:Srgap1 UTSW 10 121925941 missense probably benign 0.01
R6435:Srgap1 UTSW 10 121800827 missense possibly damaging 0.94
R6597:Srgap1 UTSW 10 121792371 missense probably benign 0.11
R6798:Srgap1 UTSW 10 121925904 missense probably damaging 1.00
R6897:Srgap1 UTSW 10 121785618 missense probably damaging 0.96
X0063:Srgap1 UTSW 10 121785412 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- AGCGACTCCAACGAATGCTG -3'
(R):5'- TCTTTTCAGAGCCAGGGAACTTG -3'

Sequencing Primer
(F):5'- AACGAATGCTGGCACTTTCC -3'
(R):5'- CGAGATGACTTTGCTGTC -3'
Posted On2016-09-01