Incidental Mutation 'R5433:Olfr30'
ID428168
Institutional Source Beutler Lab
Gene Symbol Olfr30
Ensembl Gene ENSMUSG00000043314
Gene Nameolfactory receptor 30
SynonymsMTPCR07, MOR281-1, GA_x6K02T2NKPP-957001-957948
MMRRC Submission 042998-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R5433 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location58454105-58462270 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 58455854 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 32 (V32M)
Ref Sequence ENSEMBL: ENSMUSP00000148907 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000055204] [ENSMUST00000064614] [ENSMUST00000215691]
Predicted Effect probably damaging
Transcript: ENSMUST00000055204
AA Change: V32M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000055961
Gene: ENSMUSG00000043314
AA Change: V32M

DomainStartEndE-ValueType
Pfam:7tm_4 32 308 1.9e-53 PFAM
Pfam:7TM_GPCR_Srsx 36 252 1.7e-6 PFAM
Pfam:7tm_1 42 291 8.3e-25 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064614
SMART Domains Protein: ENSMUSP00000063665
Gene: ENSMUSG00000052642

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Pfam:UPAR_LY6 47 124 1.3e-6 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000215691
AA Change: V32M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Meta Mutation Damage Score 0.0584 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik T C 1: 52,925,498 S24G probably damaging Het
1810064F22Rik A G 9: 22,207,743 noncoding transcript Het
Aacs A T 5: 125,515,014 M589L probably benign Het
Adamts8 A C 9: 30,961,716 H739P probably benign Het
Atp8b2 T C 3: 89,952,909 probably benign Het
BC030500 A G 8: 58,913,009 probably benign Het
Btnl9 T A 11: 49,176,003 probably benign Het
Cd74 G T 18: 60,807,921 A31S probably benign Het
Ceacam3 G A 7: 17,159,883 A440T possibly damaging Het
Ces1d G A 8: 93,186,036 T258I probably benign Het
Col10a1 A G 10: 34,390,739 probably benign Het
Coro1b C T 19: 4,153,450 A430V probably benign Het
Cyp2c65 A T 19: 39,093,484 I485L probably benign Het
Dio1 A T 4: 107,306,780 probably benign Het
Dmxl1 G A 18: 49,867,899 probably null Het
Elp6 A G 9: 110,315,783 Y136C probably damaging Het
Gm1966 T A 7: 106,600,107 noncoding transcript Het
Gon4l A T 3: 88,896,225 Q1382L possibly damaging Het
Guca1a T C 17: 47,400,370 E17G probably damaging Het
Gucy2d G A 7: 98,449,775 G267E probably damaging Het
Hspg2 T A 4: 137,528,794 probably null Het
Il1a G T 2: 129,307,901 D26E possibly damaging Het
Iltifb T A 10: 118,294,884 I36F probably damaging Het
Kcna1 A T 6: 126,643,112 F82I probably damaging Het
Klhl18 G C 9: 110,436,127 N335K possibly damaging Het
Lamtor5 T G 3: 107,282,007 C120G probably benign Het
Lars A G 18: 42,251,298 C72R possibly damaging Het
Lrrfip1 T G 1: 91,087,126 probably null Het
Mapkapk3 T C 9: 107,256,292 D349G probably damaging Het
Mknk2 A T 10: 80,667,225 I421N probably benign Het
Myh6 A G 14: 54,953,924 I820T probably benign Het
Notch2 T G 3: 98,126,134 V1182G probably damaging Het
Olfr1 AGCGGTCGTAGGC AGC 11: 73,395,654 probably null Het
Olfr366 T G 2: 37,219,672 F61C probably damaging Het
Ppfia4 A T 1: 134,317,894 S641T probably damaging Het
Prok1 T A 3: 107,239,633 H6L probably benign Het
Ptprm A T 17: 66,693,473 V1172E probably damaging Het
Rasal3 C T 17: 32,393,601 R762Q probably benign Het
Rgs20 G T 1: 5,070,110 A23E possibly damaging Het
Rprd1a T C 18: 24,507,231 T163A probably benign Het
Rrm1 A T 7: 102,465,767 N37I probably damaging Het
Shc4 T A 2: 125,639,430 E520V probably damaging Het
Slc14a2 G T 18: 78,208,928 P56Q probably damaging Het
Slc22a3 C T 17: 12,458,490 G264S probably damaging Het
Svil A G 18: 5,059,294 E770G probably damaging Het
Svop A G 5: 114,060,125 V129A probably damaging Het
Szt2 A T 4: 118,375,466 probably benign Het
Tcof1 T C 18: 60,818,033 probably benign Het
Tctex1d1 A G 4: 103,002,503 E84G possibly damaging Het
Tmem30a T A 9: 79,780,648 I80F probably damaging Het
Vmn2r16 G T 5: 109,363,842 L638F probably damaging Het
Xkr7 T A 2: 153,054,324 I366N probably damaging Het
Zer1 A G 2: 30,100,986 probably benign Het
Other mutations in Olfr30
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01305:Olfr30 APN 11 58455262 missense probably damaging 1.00
IGL02001:Olfr30 APN 11 58455509 missense probably benign 0.33
IGL02170:Olfr30 APN 11 58455080 missense probably damaging 1.00
IGL02638:Olfr30 APN 11 58455047 missense probably damaging 1.00
ANU22:Olfr30 UTSW 11 58455262 missense probably damaging 1.00
R0502:Olfr30 UTSW 11 58455314 missense possibly damaging 0.54
R0784:Olfr30 UTSW 11 58455305 missense possibly damaging 0.63
R1300:Olfr30 UTSW 11 58455841 missense probably damaging 1.00
R1451:Olfr30 UTSW 11 58455532 missense probably benign 0.00
R1642:Olfr30 UTSW 11 58455838 missense probably benign
R1754:Olfr30 UTSW 11 58455262 missense probably damaging 1.00
R1854:Olfr30 UTSW 11 58455431 missense probably damaging 1.00
R2920:Olfr30 UTSW 11 58455577 missense probably damaging 1.00
R3160:Olfr30 UTSW 11 58455227 missense probably damaging 1.00
R3162:Olfr30 UTSW 11 58455227 missense probably damaging 1.00
R4791:Olfr30 UTSW 11 58455544 missense possibly damaging 0.83
R4964:Olfr30 UTSW 11 58455907 missense probably benign 0.05
R5543:Olfr30 UTSW 11 58455167 missense probably damaging 1.00
R6649:Olfr30 UTSW 11 58455568 missense probably damaging 0.98
R6653:Olfr30 UTSW 11 58455568 missense probably damaging 0.98
R7388:Olfr30 UTSW 11 58455655 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCCGAAAGAGATGCTCGTCC -3'
(R):5'- TGGTTTTCCTGTGAAATAATGACCC -3'

Sequencing Primer
(F):5'- GAGATGCTCGTCCAACCAAAGAG -3'
(R):5'- TGACCCTACAAATACTGGCTAGGTG -3'
Posted On2016-09-01