Incidental Mutation 'R5433:Or1e16'
ID 428169
Institutional Source Beutler Lab
Gene Symbol Or1e16
Ensembl Gene ENSMUSG00000069823
Gene Name olfactory receptor family 1 subfamily E member 16
Synonyms GA_x6K02T2P1NL-3556334-3555390, MOR135-13, I54, Olfr1
MMRRC Submission 042998-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.196) question?
Stock # R5433 (G1)
Quality Score 217
Status Validated
Chromosome 11
Chromosomal Location 73285902-73290321 bp(-) (GRCm39)
Type of Mutation frame shift
DNA Base Change (assembly) AGCGGTCGTAGGC to AGC at 73286480 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000120899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000120303] [ENSMUST00000131253] [ENSMUST00000134011]
AlphaFold Q8VGI1
Predicted Effect probably null
Transcript: ENSMUST00000120303
SMART Domains Protein: ENSMUSP00000113707
Gene: ENSMUSG00000069823

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 8.7e-60 PFAM
Pfam:7tm_1 41 290 2e-27 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000131253
SMART Domains Protein: ENSMUSP00000120899
Gene: ENSMUSG00000069823

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srx 31 184 1.2e-6 PFAM
Pfam:7TM_GPCR_Srsx 35 171 6.1e-8 PFAM
Pfam:7tm_1 41 191 3.6e-30 PFAM
Pfam:7tm_4 139 196 1.4e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000134011
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700019D03Rik T C 1: 52,964,657 (GRCm39) S24G probably damaging Het
1810064F22Rik A G 9: 22,119,039 (GRCm39) noncoding transcript Het
Aacs A T 5: 125,592,078 (GRCm39) M589L probably benign Het
Adamts8 A C 9: 30,873,012 (GRCm39) H739P probably benign Het
Atp8b2 T C 3: 89,860,216 (GRCm39) probably benign Het
BC030500 A G 8: 59,366,043 (GRCm39) probably benign Het
Btnl9 T A 11: 49,066,830 (GRCm39) probably benign Het
Cd74 G T 18: 60,940,993 (GRCm39) A31S probably benign Het
Ceacam3 G A 7: 16,893,808 (GRCm39) A440T possibly damaging Het
Ces1d G A 8: 93,912,664 (GRCm39) T258I probably benign Het
Col10a1 A G 10: 34,266,735 (GRCm39) probably benign Het
Coro1b C T 19: 4,203,449 (GRCm39) A430V probably benign Het
Cyp2c65 A T 19: 39,081,928 (GRCm39) I485L probably benign Het
Dio1 A T 4: 107,163,977 (GRCm39) probably benign Het
Dmxl1 G A 18: 50,000,966 (GRCm39) probably null Het
Dynlt5 A G 4: 102,859,700 (GRCm39) E84G possibly damaging Het
Elp6 A G 9: 110,144,851 (GRCm39) Y136C probably damaging Het
Gon4l A T 3: 88,803,532 (GRCm39) Q1382L possibly damaging Het
Guca1a T C 17: 47,711,295 (GRCm39) E17G probably damaging Het
Gucy2d G A 7: 98,098,982 (GRCm39) G267E probably damaging Het
Gvin3 T A 7: 106,199,314 (GRCm39) noncoding transcript Het
Hspg2 T A 4: 137,256,105 (GRCm39) probably null Het
Il1a G T 2: 129,149,821 (GRCm39) D26E possibly damaging Het
Il22b T A 10: 118,130,789 (GRCm39) I36F probably damaging Het
Kcna1 A T 6: 126,620,075 (GRCm39) F82I probably damaging Het
Klhl18 G C 9: 110,265,195 (GRCm39) N335K possibly damaging Het
Lamtor5 T G 3: 107,189,323 (GRCm39) C120G probably benign Het
Lars1 A G 18: 42,384,363 (GRCm39) C72R possibly damaging Het
Lrrfip1 T G 1: 91,014,848 (GRCm39) probably null Het
Mapkapk3 T C 9: 107,133,491 (GRCm39) D349G probably damaging Het
Mknk2 A T 10: 80,503,059 (GRCm39) I421N probably benign Het
Myh6 A G 14: 55,191,381 (GRCm39) I820T probably benign Het
Notch2 T G 3: 98,033,450 (GRCm39) V1182G probably damaging Het
Or1af1 T G 2: 37,109,684 (GRCm39) F61C probably damaging Het
Or2z2 C T 11: 58,346,680 (GRCm39) V32M probably damaging Het
Ppfia4 A T 1: 134,245,632 (GRCm39) S641T probably damaging Het
Prok1 T A 3: 107,146,949 (GRCm39) H6L probably benign Het
Ptprm A T 17: 67,000,468 (GRCm39) V1172E probably damaging Het
Rasal3 C T 17: 32,612,575 (GRCm39) R762Q probably benign Het
Rgs20 G T 1: 5,140,333 (GRCm39) A23E possibly damaging Het
Rprd1a T C 18: 24,640,288 (GRCm39) T163A probably benign Het
Rrm1 A T 7: 102,114,974 (GRCm39) N37I probably damaging Het
Shc4 T A 2: 125,481,350 (GRCm39) E520V probably damaging Het
Slc14a2 G T 18: 78,252,143 (GRCm39) P56Q probably damaging Het
Slc22a3 C T 17: 12,677,377 (GRCm39) G264S probably damaging Het
Svil A G 18: 5,059,294 (GRCm39) E770G probably damaging Het
Svop A G 5: 114,198,186 (GRCm39) V129A probably damaging Het
Szt2 A T 4: 118,232,663 (GRCm39) probably benign Het
Tcof1 T C 18: 60,951,105 (GRCm39) probably benign Het
Tmem30a T A 9: 79,687,930 (GRCm39) I80F probably damaging Het
Vmn2r16 G T 5: 109,511,708 (GRCm39) L638F probably damaging Het
Xkr7 T A 2: 152,896,244 (GRCm39) I366N probably damaging Het
Zer1 A G 2: 29,990,998 (GRCm39) probably benign Het
Other mutations in Or1e16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01380:Or1e16 APN 11 73,286,017 (GRCm39) missense probably damaging 0.98
IGL01938:Or1e16 APN 11 73,286,471 (GRCm39) missense probably damaging 1.00
IGL02270:Or1e16 APN 11 73,286,191 (GRCm39) missense probably benign
IGL03287:Or1e16 APN 11 73,286,845 (GRCm39) start codon destroyed probably null 1.00
R0006:Or1e16 UTSW 11 73,286,314 (GRCm39) missense probably damaging 0.99
R0907:Or1e16 UTSW 11 73,285,945 (GRCm39) missense probably damaging 0.97
R1982:Or1e16 UTSW 11 73,285,918 (GRCm39) missense probably benign 0.00
R3804:Or1e16 UTSW 11 73,286,776 (GRCm39) missense probably benign 0.01
R4064:Or1e16 UTSW 11 73,286,348 (GRCm39) missense probably benign 0.04
R4171:Or1e16 UTSW 11 73,286,365 (GRCm39) missense probably damaging 1.00
R4724:Or1e16 UTSW 11 73,285,981 (GRCm39) missense probably damaging 1.00
R4732:Or1e16 UTSW 11 73,286,521 (GRCm39) missense probably benign 0.03
R4733:Or1e16 UTSW 11 73,286,521 (GRCm39) missense probably benign 0.03
R5030:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5097:Or1e16 UTSW 11 73,286,119 (GRCm39) missense probably damaging 1.00
R5098:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5101:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5135:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5137:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5192:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5193:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5193:Or1e16 UTSW 11 73,286,479 (GRCm39) frame shift probably null
R5197:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5220:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5221:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5222:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5258:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5297:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5396:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5398:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5399:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5432:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5531:Or1e16 UTSW 11 73,286,003 (GRCm39) missense probably benign 0.26
R5634:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5714:Or1e16 UTSW 11 73,286,187 (GRCm39) splice site probably null
R5812:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5813:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5814:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5815:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5913:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5955:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5956:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R5968:Or1e16 UTSW 11 73,286,018 (GRCm39) missense possibly damaging 0.75
R6029:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6034:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6034:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6176:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6177:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6178:Or1e16 UTSW 11 73,286,480 (GRCm39) frame shift probably null
R6196:Or1e16 UTSW 11 73,286,299 (GRCm39) missense probably benign 0.08
R6995:Or1e16 UTSW 11 73,286,410 (GRCm39) missense probably benign
R7035:Or1e16 UTSW 11 73,286,544 (GRCm39) missense probably benign 0.00
R7470:Or1e16 UTSW 11 73,286,714 (GRCm39) missense probably damaging 1.00
R7530:Or1e16 UTSW 11 73,279,189 (GRCm39) missense possibly damaging 0.55
R8461:Or1e16 UTSW 11 73,285,982 (GRCm39) missense probably damaging 1.00
R9149:Or1e16 UTSW 11 73,286,853 (GRCm39) unclassified probably benign
R9279:Or1e16 UTSW 11 73,279,789 (GRCm39) missense probably benign 0.05
R9293:Or1e16 UTSW 11 73,285,955 (GRCm39) missense probably damaging 0.99
R9682:Or1e16 UTSW 11 73,286,025 (GRCm39) missense probably benign 0.03
R9752:Or1e16 UTSW 11 73,286,479 (GRCm39) missense possibly damaging 0.88
Predicted Primers PCR Primer
(F):5'- TAACACGGGTGTCAGAGCAG -3'
(R):5'- TCCACACACCCATGTACTTG -3'

Sequencing Primer
(F):5'- TGTCAGAGCAGGCCAGCTTTAG -3'
(R):5'- ATGTACTTGTTTCTCAGCAACTTG -3'
Posted On 2016-09-01