Incidental Mutation 'R5434:Idh1'
ID428184
Institutional Source Beutler Lab
Gene Symbol Idh1
Ensembl Gene ENSMUSG00000025950
Gene Nameisocitrate dehydrogenase 1 (NADP+), soluble
SynonymsId-1, Idh-1, IDPc, E030024J03Rik
MMRRC Submission 042999-MU
Accession Numbers

Genbank: NM_001111320, NM_010497 

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5434 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location65158616-65186500 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 65175336 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 6 (Q6L)
Ref Sequence ENSEMBL: ENSMUSP00000140694 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000097709] [ENSMUST00000149310] [ENSMUST00000169032] [ENSMUST00000186222] [ENSMUST00000188109] [ENSMUST00000188876] [ENSMUST00000191459]
Predicted Effect probably benign
Transcript: ENSMUST00000097709
AA Change: Q6L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000095316
Gene: ENSMUSG00000025950
AA Change: Q6L

DomainStartEndE-ValueType
Iso_dh 9 401 1.05e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000149310
AA Change: Q6L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000117853
Gene: ENSMUSG00000025950
AA Change: Q6L

DomainStartEndE-ValueType
Iso_dh 9 143 1.74e-1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000169032
AA Change: Q6L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000127307
Gene: ENSMUSG00000025950
AA Change: Q6L

DomainStartEndE-ValueType
Iso_dh 9 401 1.05e-133 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186222
AA Change: Q6L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000140694
Gene: ENSMUSG00000025950
AA Change: Q6L

DomainStartEndE-ValueType
Pfam:Iso_dh 9 84 3.8e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188109
AA Change: Q6L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140757
Gene: ENSMUSG00000025950
AA Change: Q6L

DomainStartEndE-ValueType
Iso_dh 9 202 1.1e-10 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188876
AA Change: Q6L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139906
Gene: ENSMUSG00000025950
AA Change: Q6L

DomainStartEndE-ValueType
Iso_dh 9 187 2.2e-9 SMART
Predicted Effect unknown
Transcript: ENSMUST00000191459
AA Change: Q6L
Meta Mutation Damage Score 0.0556 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Isocitrate dehydrogenases catalyze the oxidative decarboxylation of isocitrate to 2-oxoglutarate. These enzymes belong to two distinct subclasses, one of which utilizes NAD(+) as the electron acceptor and the other NADP(+). Five isocitrate dehydrogenases have been reported: three NAD(+)-dependent isocitrate dehydrogenases, which localize to the mitochondrial matrix, and two NADP(+)-dependent isocitrate dehydrogenases, one of which is mitochondrial and the other predominantly cytosolic. Each NADP(+)-dependent isozyme is a homodimer. The protein encoded by this gene is the NADP(+)-dependent isocitrate dehydrogenase found in the cytoplasm and peroxisomes. It contains the PTS-1 peroxisomal targeting signal sequence. The presence of this enzyme in peroxisomes suggests roles in the regeneration of NADPH for intraperoxisomal reductions, such as the conversion of 2, 4-dienoyl-CoAs to 3-enoyl-CoAs, as well as in peroxisomal reactions that consume 2-oxoglutarate, namely the alpha-hydroxylation of phytanic acid. The cytoplasmic enzyme serves a significant role in cytoplasmic NADPH production. Alternatively spliced transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Sep 2013]
PHENOTYPE: Electrophoretic variation has been shown in tissues of liver, kidney, spleen and muscle. Strains C57BL/6, C3H/He carry the a allele; DBA/2 carries the b allele; M.m. castaneus and M.m. molossinus carry the c allele; the d allele is found at low frequencyin M. m. molossinus in Japan. [provided by MGI curators]
Allele List at MGI

All alleles(14) : Targeted, other(3) Gene trapped(11)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A C 3: 36,875,516 D94A probably damaging Het
Angptl6 G T 9: 20,875,525 Q301K probably damaging Het
Ankfn1 T C 11: 89,453,187 Y323C probably damaging Het
Arid5b T A 10: 68,096,889 H818L possibly damaging Het
Armc4 T C 18: 7,222,550 K573R probably benign Het
Atg13 G T 2: 91,684,765 probably null Het
Bop1 T C 15: 76,455,411 M245V probably benign Het
Ccdc105 A T 10: 78,748,650 L346* probably null Het
Ces2a T A 8: 104,737,409 F224L probably damaging Het
Cntnap5b A G 1: 100,072,201 H228R probably benign Het
Col9a2 A T 4: 121,040,965 R25* probably null Het
Dcaf12 G T 4: 41,302,744 T137N probably benign Het
Dennd4c A G 4: 86,811,456 N765S probably benign Het
Dnah12 A G 14: 26,859,299 Y3162C probably damaging Het
Dpf1 G T 7: 29,311,331 C123F possibly damaging Het
Flvcr1 C A 1: 191,026,009 A29S probably benign Het
Frmd3 A T 4: 74,187,796 I560F probably damaging Het
Galnt15 G A 14: 32,049,843 V282I possibly damaging Het
Gm14412 A T 2: 177,314,612 C497S probably damaging Het
Gm20830 A T Y: 6,916,464 Y218* probably null Het
Hmcn2 C A 2: 31,420,363 T3323N probably damaging Het
Kansl2-ps A G 7: 72,673,065 noncoding transcript Het
Kcnj10 T A 1: 172,369,480 V187E probably damaging Het
Khnyn A G 14: 55,887,500 T404A probably damaging Het
Lrp1b T A 2: 41,770,868 N76I probably damaging Het
Lrrc9 G A 12: 72,454,088 C196Y probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mgp T A 6: 136,872,774 N62I probably benign Het
Ms4a6c T A 19: 11,471,224 H40Q probably benign Het
Necab3 A G 2: 154,547,459 S121P probably damaging Het
Nfkb1 T A 3: 135,626,611 K128* probably null Het
Nr4a3 A T 4: 48,067,861 R486W probably damaging Het
Nwd2 A G 5: 63,807,648 K1525R probably benign Het
Pbrm1 G T 14: 31,085,011 D1085Y probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rbm15 A G 3: 107,330,467 S872P possibly damaging Het
Retsat A G 6: 72,601,535 I77V probably damaging Het
Rpl32 A G 6: 115,807,035 F77L probably benign Het
Ryr3 A T 2: 112,794,469 V2202D probably damaging Het
Sars2 G A 7: 28,750,291 R387Q probably null Het
Serpinb3d G T 1: 107,078,533 T275N probably benign Het
Sf3a1 C A 11: 4,174,041 P296Q probably damaging Het
Sh3bgr A G 16: 96,224,544 probably benign Het
St3gal3 A G 4: 117,940,050 L332P probably damaging Het
Ston1 A G 17: 88,645,311 probably benign Het
Syne2 T A 12: 75,971,875 S3383T probably damaging Het
Tnfsf14 A G 17: 57,192,592 S87P probably benign Het
Trap1 T C 16: 4,044,665 D583G probably benign Het
Ube2cbp A T 9: 86,427,407 I212N possibly damaging Het
Usp34 T A 11: 23,412,271 D1572E probably damaging Het
Vmn1r179 A T 7: 23,928,962 T193S probably benign Het
Vmn2r111 C A 17: 22,548,489 V676L probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wls C T 3: 159,934,340 R536C probably damaging Het
Zfhx3 A G 8: 108,792,399 D51G probably damaging Het
Other mutations in Idh1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00786:Idh1 APN 1 65166243 missense probably damaging 1.00
IGL00790:Idh1 APN 1 65166122 missense possibly damaging 0.94
IGL00979:Idh1 APN 1 65171149 missense probably damaging 1.00
IGL01397:Idh1 APN 1 65168595 missense possibly damaging 0.62
IGL02226:Idh1 APN 1 65161922 missense probably damaging 1.00
IGL02933:Idh1 APN 1 65161913 missense probably damaging 1.00
B5639:Idh1 UTSW 1 65165098 critical splice donor site probably null
R0310:Idh1 UTSW 1 65161920 missense probably damaging 1.00
R0865:Idh1 UTSW 1 65161156 missense probably benign
R1172:Idh1 UTSW 1 65161160 missense probably benign 0.00
R1173:Idh1 UTSW 1 65161160 missense probably benign 0.00
R1174:Idh1 UTSW 1 65161160 missense probably benign 0.00
R1535:Idh1 UTSW 1 65168538 missense probably damaging 1.00
R1833:Idh1 UTSW 1 65161114 missense probably benign
R2135:Idh1 UTSW 1 65161919 missense probably damaging 1.00
R5478:Idh1 UTSW 1 65161838 missense probably benign 0.04
R5633:Idh1 UTSW 1 65165136 missense probably damaging 1.00
R6152:Idh1 UTSW 1 65159530 missense probably damaging 1.00
R6249:Idh1 UTSW 1 65166219 missense probably damaging 1.00
R6252:Idh1 UTSW 1 65168531 missense probably benign
R7238:Idh1 UTSW 1 65166125 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCCAGGTACAATTTGAGATAACAATTG -3'
(R):5'- CCTGATTCAGAAGCAGCAGG -3'

Sequencing Primer
(F):5'- CAATTGTTTCTGAGTTTGCTAGCTAC -3'
(R):5'- CGTGACAAGGTACAAACC -3'
Posted On2016-09-01