Incidental Mutation 'R5434:Kcnj10'
ID428187
Institutional Source Beutler Lab
Gene Symbol Kcnj10
Ensembl Gene ENSMUSG00000044708
Gene Namepotassium inwardly-rectifying channel, subfamily J, member 10
SynonymsBIR10, Kir4.1, Kir1.2, Kir4.1, BIRK-1
MMRRC Submission 042999-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5434 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location172341210-172374085 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 172369480 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 187 (V187E)
Ref Sequence ENSEMBL: ENSMUSP00000054356 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056136]
Predicted Effect probably damaging
Transcript: ENSMUST00000056136
AA Change: V187E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000054356
Gene: ENSMUSG00000044708
AA Change: V187E

DomainStartEndE-ValueType
Pfam:IRK 31 363 2.2e-136 PFAM
Meta Mutation Damage Score 0.17 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the inward rectifier-type potassium channel family, characterized by having a greater tendency to allow potassium to flow into, rather than out of, a cell. The encoded protein may form a heterodimer with another potassium channel protein and may be responsible for the potassium buffering action of glial cells in the brain. Mutations in this gene have been associated with seizure susceptibility of common idiopathic generalized epilepsy syndromes. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice show increased input resistance and high depolarization of retinal Muller cells, loss of the endocochlear potential, motor coordination deficits and hindlimb paralysis, and a hypomyelination and spongiform vacuolation in the spinalcord associated with severe axonal pathology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A C 3: 36,875,516 D94A probably damaging Het
Angptl6 G T 9: 20,875,525 Q301K probably damaging Het
Ankfn1 T C 11: 89,453,187 Y323C probably damaging Het
Arid5b T A 10: 68,096,889 H818L possibly damaging Het
Armc4 T C 18: 7,222,550 K573R probably benign Het
Atg13 G T 2: 91,684,765 probably null Het
Bop1 T C 15: 76,455,411 M245V probably benign Het
Ccdc105 A T 10: 78,748,650 L346* probably null Het
Ces2a T A 8: 104,737,409 F224L probably damaging Het
Cntnap5b A G 1: 100,072,201 H228R probably benign Het
Col9a2 A T 4: 121,040,965 R25* probably null Het
Dcaf12 G T 4: 41,302,744 T137N probably benign Het
Dennd4c A G 4: 86,811,456 N765S probably benign Het
Dnah12 A G 14: 26,859,299 Y3162C probably damaging Het
Dpf1 G T 7: 29,311,331 C123F possibly damaging Het
Flvcr1 C A 1: 191,026,009 A29S probably benign Het
Frmd3 A T 4: 74,187,796 I560F probably damaging Het
Galnt15 G A 14: 32,049,843 V282I possibly damaging Het
Gm14412 A T 2: 177,314,612 C497S probably damaging Het
Gm20830 A T Y: 6,916,464 Y218* probably null Het
Hmcn2 C A 2: 31,420,363 T3323N probably damaging Het
Idh1 T A 1: 65,175,336 Q6L probably benign Het
Kansl2-ps A G 7: 72,673,065 noncoding transcript Het
Khnyn A G 14: 55,887,500 T404A probably damaging Het
Lrp1b T A 2: 41,770,868 N76I probably damaging Het
Lrrc9 G A 12: 72,454,088 C196Y probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mgp T A 6: 136,872,774 N62I probably benign Het
Ms4a6c T A 19: 11,471,224 H40Q probably benign Het
Necab3 A G 2: 154,547,459 S121P probably damaging Het
Nfkb1 T A 3: 135,626,611 K128* probably null Het
Nr4a3 A T 4: 48,067,861 R486W probably damaging Het
Nwd2 A G 5: 63,807,648 K1525R probably benign Het
Pbrm1 G T 14: 31,085,011 D1085Y probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rbm15 A G 3: 107,330,467 S872P possibly damaging Het
Retsat A G 6: 72,601,535 I77V probably damaging Het
Rpl32 A G 6: 115,807,035 F77L probably benign Het
Ryr3 A T 2: 112,794,469 V2202D probably damaging Het
Sars2 G A 7: 28,750,291 R387Q probably null Het
Serpinb3d G T 1: 107,078,533 T275N probably benign Het
Sf3a1 C A 11: 4,174,041 P296Q probably damaging Het
Sh3bgr A G 16: 96,224,544 probably benign Het
St3gal3 A G 4: 117,940,050 L332P probably damaging Het
Ston1 A G 17: 88,645,311 probably benign Het
Syne2 T A 12: 75,971,875 S3383T probably damaging Het
Tnfsf14 A G 17: 57,192,592 S87P probably benign Het
Trap1 T C 16: 4,044,665 D583G probably benign Het
Ube2cbp A T 9: 86,427,407 I212N possibly damaging Het
Usp34 T A 11: 23,412,271 D1572E probably damaging Het
Vmn1r179 A T 7: 23,928,962 T193S probably benign Het
Vmn2r111 C A 17: 22,548,489 V676L probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wls C T 3: 159,934,340 R536C probably damaging Het
Zfhx3 A G 8: 108,792,399 D51G probably damaging Het
Other mutations in Kcnj10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01771:Kcnj10 APN 1 172369583 missense probably benign 0.11
IGL02743:Kcnj10 APN 1 172369654 missense possibly damaging 0.95
R0052:Kcnj10 UTSW 1 172368924 missense probably benign 0.30
R0490:Kcnj10 UTSW 1 172369452 missense probably damaging 0.96
R1424:Kcnj10 UTSW 1 172369255 missense probably damaging 1.00
R2153:Kcnj10 UTSW 1 172369888 missense possibly damaging 0.90
R3735:Kcnj10 UTSW 1 172369966 missense possibly damaging 0.81
R3826:Kcnj10 UTSW 1 172370049 missense probably damaging 1.00
R4725:Kcnj10 UTSW 1 172369159 missense probably damaging 1.00
R4726:Kcnj10 UTSW 1 172369072 missense probably damaging 1.00
R4727:Kcnj10 UTSW 1 172369699 missense probably damaging 1.00
R5755:Kcnj10 UTSW 1 172369594 missense possibly damaging 0.81
R6146:Kcnj10 UTSW 1 172369325 nonsense probably null
R7029:Kcnj10 UTSW 1 172368996 missense probably benign 0.07
R7235:Kcnj10 UTSW 1 172369426 missense probably damaging 0.98
R7350:Kcnj10 UTSW 1 172369260 missense possibly damaging 0.52
Predicted Primers PCR Primer
(F):5'- TGGCTTCCGCTACATCAGTG -3'
(R):5'- AAGGGGCTGGTCTCATCTAC -3'

Sequencing Primer
(F):5'- CTTCCGCTACATCAGTGAGGAATG -3'
(R):5'- GGCTGGTCTCATCTACCACGTG -3'
Posted On2016-09-01