Incidental Mutation 'R5434:Necab3'
ID428193
Institutional Source Beutler Lab
Gene Symbol Necab3
Ensembl Gene ENSMUSG00000027489
Gene NameN-terminal EF-hand calcium binding protein 3
SynonymsApba2bp, XB51, 2900010M17Rik, Nip1
MMRRC Submission 042999-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.157) question?
Stock #R5434 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location154544399-154558890 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 154547459 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 121 (S121P)
Ref Sequence ENSEMBL: ENSMUSP00000117090 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000895] [ENSMUST00000045116] [ENSMUST00000104928] [ENSMUST00000109709] [ENSMUST00000109716] [ENSMUST00000125793] [ENSMUST00000226583]
Predicted Effect probably damaging
Transcript: ENSMUST00000000895
AA Change: S155P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000000895
Gene: ENSMUSG00000027489
AA Change: S155P

DomainStartEndE-ValueType
Pfam:EF-hand_1 31 58 7.3e-8 PFAM
Pfam:EF-hand_5 32 57 4.6e-9 PFAM
low complexity region 180 203 N/A INTRINSIC
coiled coil region 209 237 N/A INTRINSIC
Pfam:ABM 252 327 4.4e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000045116
SMART Domains Protein: ENSMUSP00000035523
Gene: ENSMUSG00000038523

DomainStartEndE-ValueType
Pfam:Bclt 1 194 2.1e-90 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000104928
SMART Domains Protein: ENSMUSP00000100532
Gene: ENSMUSG00000078129

DomainStartEndE-ValueType
ACTIN 2 345 2.52e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000109709
SMART Domains Protein: ENSMUSP00000105331
Gene: ENSMUSG00000038523

DomainStartEndE-ValueType
Pfam:Bclt 1 207 1.9e-105 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109716
AA Change: S155P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000105338
Gene: ENSMUSG00000027489
AA Change: S155P

DomainStartEndE-ValueType
Pfam:EF-hand_1 31 59 6.9e-8 PFAM
Pfam:EF-hand_5 32 57 1.7e-9 PFAM
low complexity region 180 203 N/A INTRINSIC
Pfam:ABM 232 303 2.7e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124382
Predicted Effect probably damaging
Transcript: ENSMUST00000125793
AA Change: S121P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000117090
Gene: ENSMUSG00000027489
AA Change: S121P

DomainStartEndE-ValueType
low complexity region 146 168 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135641
Predicted Effect probably benign
Transcript: ENSMUST00000226583
Meta Mutation Damage Score 0.17 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene interacts with the amino-terminal domain of the neuron-specific X11-like protein (X11L), inhibits the association of X11L with amyloid precursor protein through a non-competitive mechanism, and abolishes the suppression of beta-amyloid production by X11L. This protein, together with X11L, may play an important role in the regulatory system of amyloid precursor protein metabolism and beta-amyloid generation. The protein is phosphorylated by NIMA-related expressed kinase 2, and localizes to the Golgi apparatus. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A C 3: 36,875,516 D94A probably damaging Het
Angptl6 G T 9: 20,875,525 Q301K probably damaging Het
Ankfn1 T C 11: 89,453,187 Y323C probably damaging Het
Arid5b T A 10: 68,096,889 H818L possibly damaging Het
Armc4 T C 18: 7,222,550 K573R probably benign Het
Atg13 G T 2: 91,684,765 probably null Het
Bop1 T C 15: 76,455,411 M245V probably benign Het
Ccdc105 A T 10: 78,748,650 L346* probably null Het
Ces2a T A 8: 104,737,409 F224L probably damaging Het
Cntnap5b A G 1: 100,072,201 H228R probably benign Het
Col9a2 A T 4: 121,040,965 R25* probably null Het
Dcaf12 G T 4: 41,302,744 T137N probably benign Het
Dennd4c A G 4: 86,811,456 N765S probably benign Het
Dnah12 A G 14: 26,859,299 Y3162C probably damaging Het
Dpf1 G T 7: 29,311,331 C123F possibly damaging Het
Flvcr1 C A 1: 191,026,009 A29S probably benign Het
Frmd3 A T 4: 74,187,796 I560F probably damaging Het
Galnt15 G A 14: 32,049,843 V282I possibly damaging Het
Gm14412 A T 2: 177,314,612 C497S probably damaging Het
Gm20830 A T Y: 6,916,464 Y218* probably null Het
Hmcn2 C A 2: 31,420,363 T3323N probably damaging Het
Idh1 T A 1: 65,175,336 Q6L probably benign Het
Kansl2-ps A G 7: 72,673,065 noncoding transcript Het
Kcnj10 T A 1: 172,369,480 V187E probably damaging Het
Khnyn A G 14: 55,887,500 T404A probably damaging Het
Lrp1b T A 2: 41,770,868 N76I probably damaging Het
Lrrc9 G A 12: 72,454,088 C196Y probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mgp T A 6: 136,872,774 N62I probably benign Het
Ms4a6c T A 19: 11,471,224 H40Q probably benign Het
Nfkb1 T A 3: 135,626,611 K128* probably null Het
Nr4a3 A T 4: 48,067,861 R486W probably damaging Het
Nwd2 A G 5: 63,807,648 K1525R probably benign Het
Pbrm1 G T 14: 31,085,011 D1085Y probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rbm15 A G 3: 107,330,467 S872P possibly damaging Het
Retsat A G 6: 72,601,535 I77V probably damaging Het
Rpl32 A G 6: 115,807,035 F77L probably benign Het
Ryr3 A T 2: 112,794,469 V2202D probably damaging Het
Sars2 G A 7: 28,750,291 R387Q probably null Het
Serpinb3d G T 1: 107,078,533 T275N probably benign Het
Sf3a1 C A 11: 4,174,041 P296Q probably damaging Het
Sh3bgr A G 16: 96,224,544 probably benign Het
St3gal3 A G 4: 117,940,050 L332P probably damaging Het
Ston1 A G 17: 88,645,311 probably benign Het
Syne2 T A 12: 75,971,875 S3383T probably damaging Het
Tnfsf14 A G 17: 57,192,592 S87P probably benign Het
Trap1 T C 16: 4,044,665 D583G probably benign Het
Ube2cbp A T 9: 86,427,407 I212N possibly damaging Het
Usp34 T A 11: 23,412,271 D1572E probably damaging Het
Vmn1r179 A T 7: 23,928,962 T193S probably benign Het
Vmn2r111 C A 17: 22,548,489 V676L probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wls C T 3: 159,934,340 R536C probably damaging Het
Zfhx3 A G 8: 108,792,399 D51G probably damaging Het
Other mutations in Necab3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00090:Necab3 APN 2 154547568 unclassified probably benign
IGL01515:Necab3 APN 2 154554691 missense probably damaging 1.00
IGL02438:Necab3 APN 2 154546044 missense probably damaging 1.00
IGL03150:Necab3 APN 2 154554742 missense probably damaging 1.00
R0092:Necab3 UTSW 2 154558739 missense possibly damaging 0.89
R0102:Necab3 UTSW 2 154545312 missense probably damaging 1.00
R0102:Necab3 UTSW 2 154545312 missense probably damaging 1.00
R0219:Necab3 UTSW 2 154546093 missense probably benign 0.17
R0656:Necab3 UTSW 2 154546303 missense probably null 0.28
R1728:Necab3 UTSW 2 154546875 missense probably benign 0.09
R1729:Necab3 UTSW 2 154546875 missense probably benign 0.09
R2192:Necab3 UTSW 2 154547079 missense possibly damaging 0.62
R4622:Necab3 UTSW 2 154555582 critical splice donor site probably null
R5577:Necab3 UTSW 2 154545156 unclassified probably null
R6603:Necab3 UTSW 2 154554922 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTCCTGGGTCTTTGAAGCC -3'
(R):5'- AAGTGAGTGGTAACTAGCTTGTGC -3'

Sequencing Primer
(F):5'- TGGGTCTTTGAAGCCCAGCC -3'
(R):5'- CTTGTGCTGGCCTGCATGC -3'
Posted On2016-09-01