Incidental Mutation 'R5434:Angptl6'
ID428215
Institutional Source Beutler Lab
Gene Symbol Angptl6
Ensembl Gene ENSMUSG00000038742
Gene Nameangiopoietin-like 6
SynonymsAngiopoietin-related growth factor, 6330404E11Rik, Arp5, AGF
MMRRC Submission 042999-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.277) question?
Stock #R5434 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location20873808-20879727 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 20875525 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 301 (Q301K)
Ref Sequence ENSEMBL: ENSMUSP00000035784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000043726] [ENSMUST00000043911]
Predicted Effect probably damaging
Transcript: ENSMUST00000043726
AA Change: Q301K

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035784
Gene: ENSMUSG00000038742
AA Change: Q301K

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
coiled coil region 51 77 N/A INTRINSIC
coiled coil region 126 164 N/A INTRINSIC
low complexity region 180 197 N/A INTRINSIC
FBG 242 455 7.15e-88 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000043911
SMART Domains Protein: ENSMUSP00000045384
Gene: ENSMUSG00000038884

DomainStartEndE-ValueType
Pfam:UPF0515 16 272 1.3e-127 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175820
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176990
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177067
Meta Mutation Damage Score 0.28 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (57/57)
MGI Phenotype PHENOTYPE: Most mice homozygous for a knock-out allele die around E13 with cardiovascular defects; survivors develop obesity, lipid accumulation in skeletal muscle and liver, hyperglycemia and hyperinsulinemia, and insulin resistance accompanied by reduced energy expenditure and whole-body oxygen consumption. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A C 3: 36,875,516 D94A probably damaging Het
Ankfn1 T C 11: 89,453,187 Y323C probably damaging Het
Arid5b T A 10: 68,096,889 H818L possibly damaging Het
Armc4 T C 18: 7,222,550 K573R probably benign Het
Atg13 G T 2: 91,684,765 probably null Het
Bop1 T C 15: 76,455,411 M245V probably benign Het
Ccdc105 A T 10: 78,748,650 L346* probably null Het
Ces2a T A 8: 104,737,409 F224L probably damaging Het
Cntnap5b A G 1: 100,072,201 H228R probably benign Het
Col9a2 A T 4: 121,040,965 R25* probably null Het
Dcaf12 G T 4: 41,302,744 T137N probably benign Het
Dennd4c A G 4: 86,811,456 N765S probably benign Het
Dnah12 A G 14: 26,859,299 Y3162C probably damaging Het
Dpf1 G T 7: 29,311,331 C123F possibly damaging Het
Flvcr1 C A 1: 191,026,009 A29S probably benign Het
Frmd3 A T 4: 74,187,796 I560F probably damaging Het
Galnt15 G A 14: 32,049,843 V282I possibly damaging Het
Gm14412 A T 2: 177,314,612 C497S probably damaging Het
Gm20830 A T Y: 6,916,464 Y218* probably null Het
Hmcn2 C A 2: 31,420,363 T3323N probably damaging Het
Idh1 T A 1: 65,175,336 Q6L probably benign Het
Kansl2-ps A G 7: 72,673,065 noncoding transcript Het
Kcnj10 T A 1: 172,369,480 V187E probably damaging Het
Khnyn A G 14: 55,887,500 T404A probably damaging Het
Lrp1b T A 2: 41,770,868 N76I probably damaging Het
Lrrc9 G A 12: 72,454,088 C196Y probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mgp T A 6: 136,872,774 N62I probably benign Het
Ms4a6c T A 19: 11,471,224 H40Q probably benign Het
Necab3 A G 2: 154,547,459 S121P probably damaging Het
Nfkb1 T A 3: 135,626,611 K128* probably null Het
Nr4a3 A T 4: 48,067,861 R486W probably damaging Het
Nwd2 A G 5: 63,807,648 K1525R probably benign Het
Pbrm1 G T 14: 31,085,011 D1085Y probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rbm15 A G 3: 107,330,467 S872P possibly damaging Het
Retsat A G 6: 72,601,535 I77V probably damaging Het
Rpl32 A G 6: 115,807,035 F77L probably benign Het
Ryr3 A T 2: 112,794,469 V2202D probably damaging Het
Sars2 G A 7: 28,750,291 R387Q probably null Het
Serpinb3d G T 1: 107,078,533 T275N probably benign Het
Sf3a1 C A 11: 4,174,041 P296Q probably damaging Het
Sh3bgr A G 16: 96,224,544 probably benign Het
St3gal3 A G 4: 117,940,050 L332P probably damaging Het
Ston1 A G 17: 88,645,311 probably benign Het
Syne2 T A 12: 75,971,875 S3383T probably damaging Het
Tnfsf14 A G 17: 57,192,592 S87P probably benign Het
Trap1 T C 16: 4,044,665 D583G probably benign Het
Ube2cbp A T 9: 86,427,407 I212N possibly damaging Het
Usp34 T A 11: 23,412,271 D1572E probably damaging Het
Vmn1r179 A T 7: 23,928,962 T193S probably benign Het
Vmn2r111 C A 17: 22,548,489 V676L probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wls C T 3: 159,934,340 R536C probably damaging Het
Zfhx3 A G 8: 108,792,399 D51G probably damaging Het
Other mutations in Angptl6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02222:Angptl6 APN 9 20873907 missense probably damaging 0.99
IGL02448:Angptl6 APN 9 20875570 missense probably damaging 1.00
IGL03064:Angptl6 APN 9 20875643 nonsense probably null
R0137:Angptl6 UTSW 9 20878387 missense probably benign 0.00
R0669:Angptl6 UTSW 9 20876527 missense probably damaging 1.00
R1165:Angptl6 UTSW 9 20878308 missense probably benign
R4693:Angptl6 UTSW 9 20875302 missense probably damaging 1.00
R6518:Angptl6 UTSW 9 20875360 missense probably damaging 0.98
R7081:Angptl6 UTSW 9 20875348 missense probably damaging 0.98
R7169:Angptl6 UTSW 9 20875179 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGTATCAGCAGCTCGTGGTC -3'
(R):5'- ACTCTGATCCAGTAAGGGGTTGG -3'

Sequencing Primer
(F):5'- GTCCCCACGGCTTGTCAC -3'
(R):5'- AGTCTGTCCCTTGCCACAGG -3'
Posted On2016-09-01