Incidental Mutation 'R5434:Trap1'
ID428230
Institutional Source Beutler Lab
Gene Symbol Trap1
Ensembl Gene ENSMUSG00000005981
Gene NameTNF receptor-associated protein 1
SynonymsHSP75, 2410002K23Rik
MMRRC Submission 042999-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5434 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location4039971-4077827 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 4044665 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 583 (D583G)
Ref Sequence ENSEMBL: ENSMUSP00000006137 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000006136] [ENSMUST00000006137] [ENSMUST00000120009] [ENSMUST00000175755] [ENSMUST00000177337]
Predicted Effect probably benign
Transcript: ENSMUST00000006136
SMART Domains Protein: ENSMUSP00000006136
Gene: ENSMUSG00000005980

DomainStartEndE-ValueType
DNaseIc 6 282 5.04e-220 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000006137
AA Change: D583G

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000006137
Gene: ENSMUSG00000005981
AA Change: D583G

DomainStartEndE-ValueType
HATPase_c 110 263 3.68e-3 SMART
Pfam:HSP90 290 706 2.6e-98 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000120009
SMART Domains Protein: ENSMUSP00000113119
Gene: ENSMUSG00000005980

DomainStartEndE-ValueType
DNaseIc 6 282 5.04e-220 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125961
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137945
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144792
Predicted Effect probably benign
Transcript: ENSMUST00000175755
SMART Domains Protein: ENSMUSP00000135060
Gene: ENSMUSG00000005980

DomainStartEndE-ValueType
SCOP:d2dnja_ 1 52 3e-9 SMART
Blast:DNaseIc 1 61 2e-31 BLAST
PDB:3W3D|B 1 61 5e-27 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000177337
SMART Domains Protein: ENSMUSP00000135442
Gene: ENSMUSG00000005980

DomainStartEndE-ValueType
DNaseIc 6 200 6.86e-67 SMART
Meta Mutation Damage Score 0.0588 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a mitochondrial chaperone protein that is member of the heat shock protein 90 (HSP90) family. The encoded protein has ATPase activity and interacts with tumor necrosis factor type I. This protein may function in regulating cellular stress responses. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jan 2013]
PHENOTYPE: Mice homozygous for a gene trap allele exhibit reduced body weight; liver and spleen hyperplasia; decreased chronic inflammation and tumor incidents; deregulated mitochondrial respiration; and increased oxidative stress. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A C 3: 36,875,516 D94A probably damaging Het
Angptl6 G T 9: 20,875,525 Q301K probably damaging Het
Ankfn1 T C 11: 89,453,187 Y323C probably damaging Het
Arid5b T A 10: 68,096,889 H818L possibly damaging Het
Armc4 T C 18: 7,222,550 K573R probably benign Het
Atg13 G T 2: 91,684,765 probably null Het
Bop1 T C 15: 76,455,411 M245V probably benign Het
Ccdc105 A T 10: 78,748,650 L346* probably null Het
Ces2a T A 8: 104,737,409 F224L probably damaging Het
Cntnap5b A G 1: 100,072,201 H228R probably benign Het
Col9a2 A T 4: 121,040,965 R25* probably null Het
Dcaf12 G T 4: 41,302,744 T137N probably benign Het
Dennd4c A G 4: 86,811,456 N765S probably benign Het
Dnah12 A G 14: 26,859,299 Y3162C probably damaging Het
Dpf1 G T 7: 29,311,331 C123F possibly damaging Het
Flvcr1 C A 1: 191,026,009 A29S probably benign Het
Frmd3 A T 4: 74,187,796 I560F probably damaging Het
Galnt15 G A 14: 32,049,843 V282I possibly damaging Het
Gm14412 A T 2: 177,314,612 C497S probably damaging Het
Gm20830 A T Y: 6,916,464 Y218* probably null Het
Hmcn2 C A 2: 31,420,363 T3323N probably damaging Het
Idh1 T A 1: 65,175,336 Q6L probably benign Het
Kansl2-ps A G 7: 72,673,065 noncoding transcript Het
Kcnj10 T A 1: 172,369,480 V187E probably damaging Het
Khnyn A G 14: 55,887,500 T404A probably damaging Het
Lrp1b T A 2: 41,770,868 N76I probably damaging Het
Lrrc9 G A 12: 72,454,088 C196Y probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mgp T A 6: 136,872,774 N62I probably benign Het
Ms4a6c T A 19: 11,471,224 H40Q probably benign Het
Necab3 A G 2: 154,547,459 S121P probably damaging Het
Nfkb1 T A 3: 135,626,611 K128* probably null Het
Nr4a3 A T 4: 48,067,861 R486W probably damaging Het
Nwd2 A G 5: 63,807,648 K1525R probably benign Het
Pbrm1 G T 14: 31,085,011 D1085Y probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rbm15 A G 3: 107,330,467 S872P possibly damaging Het
Retsat A G 6: 72,601,535 I77V probably damaging Het
Rpl32 A G 6: 115,807,035 F77L probably benign Het
Ryr3 A T 2: 112,794,469 V2202D probably damaging Het
Sars2 G A 7: 28,750,291 R387Q probably null Het
Serpinb3d G T 1: 107,078,533 T275N probably benign Het
Sf3a1 C A 11: 4,174,041 P296Q probably damaging Het
Sh3bgr A G 16: 96,224,544 probably benign Het
St3gal3 A G 4: 117,940,050 L332P probably damaging Het
Ston1 A G 17: 88,645,311 probably benign Het
Syne2 T A 12: 75,971,875 S3383T probably damaging Het
Tnfsf14 A G 17: 57,192,592 S87P probably benign Het
Ube2cbp A T 9: 86,427,407 I212N possibly damaging Het
Usp34 T A 11: 23,412,271 D1572E probably damaging Het
Vmn1r179 A T 7: 23,928,962 T193S probably benign Het
Vmn2r111 C A 17: 22,548,489 V676L probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wls C T 3: 159,934,340 R536C probably damaging Het
Zfhx3 A G 8: 108,792,399 D51G probably damaging Het
Other mutations in Trap1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01155:Trap1 APN 16 4043978 nonsense probably null
IGL03087:Trap1 APN 16 4044701 splice site probably null
E0354:Trap1 UTSW 16 4065288 missense probably benign 0.01
R0034:Trap1 UTSW 16 4069030 splice site probably benign
R0034:Trap1 UTSW 16 4069030 splice site probably benign
R0316:Trap1 UTSW 16 4045560 missense probably benign
R0336:Trap1 UTSW 16 4044626 missense probably damaging 0.99
R0614:Trap1 UTSW 16 4060751 splice site probably benign
R2069:Trap1 UTSW 16 4068336 missense probably benign
R2089:Trap1 UTSW 16 4046039 nonsense probably null
R2091:Trap1 UTSW 16 4046039 nonsense probably null
R2091:Trap1 UTSW 16 4046039 nonsense probably null
R2148:Trap1 UTSW 16 4060760 missense probably damaging 0.97
R2419:Trap1 UTSW 16 4068330 missense probably benign 0.23
R3853:Trap1 UTSW 16 4054822 missense possibly damaging 0.69
R4926:Trap1 UTSW 16 4045488 missense probably benign 0.27
R5120:Trap1 UTSW 16 4044088 missense probably damaging 1.00
R5261:Trap1 UTSW 16 4056422 missense probably damaging 1.00
R6194:Trap1 UTSW 16 4054800 missense possibly damaging 0.94
R6284:Trap1 UTSW 16 4060809 missense probably benign 0.07
R6415:Trap1 UTSW 16 4043992 missense possibly damaging 0.92
R7132:Trap1 UTSW 16 4055829 missense probably benign 0.17
R7167:Trap1 UTSW 16 4052928 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCTTGAGACAAAGCTTTGATG -3'
(R):5'- AGTATTTCTGAGAGCCTCTGTCC -3'

Sequencing Primer
(F):5'- TGACATGCTAGTGCCCATG -3'
(R):5'- TGAGAGCCTCTGTCCCTAGC -3'
Posted On2016-09-01