Incidental Mutation 'R5434:Tnfsf14'
ID428233
Institutional Source Beutler Lab
Gene Symbol Tnfsf14
Ensembl Gene ENSMUSG00000005824
Gene Nametumor necrosis factor (ligand) superfamily, member 14
SynonymsLIGHT, HVEM-L
MMRRC Submission 042999-MU
Accession Numbers

Ncbi RefSeq: 019418.2; MGI: 1355317

Is this an essential gene? Probably non essential (E-score: 0.066) question?
Stock #R5434 (G1)
Quality Score203
Status Validated
Chromosome17
Chromosomal Location57189492-57194189 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57192592 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 87 (S87P)
Ref Sequence ENSEMBL: ENSMUSP00000005976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000005976]
Predicted Effect probably benign
Transcript: ENSMUST00000005976
AA Change: S87P

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000005976
Gene: ENSMUSG00000005824
AA Change: S87P

DomainStartEndE-ValueType
transmembrane domain 35 57 N/A INTRINSIC
TNF 92 239 1.22e-49 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (57/57)
MGI Phenotype Strain: 2668383; 2671122; 2180198
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the tumor necrosis factor (TNF) ligand family. This protein is a ligand for TNFRSF14, which is a member of the tumor necrosis factor receptor superfamily, and which is also known as a herpesvirus entry mediator (HVEM). This protein may function as a costimulatory factor for the activation of lymphoid cells and as a deterrent to infection by herpesvirus. This protein has been shown to stimulate the proliferation of T cells, and trigger apoptosis of various tumor cells. This protein is also reported to prevent tumor necrosis factor alpha mediated apoptosis in primary hepatocyte. Two alternatively spliced transcript variant encoding distinct isoforms have been reported. [provided by RefSeq, Jul 2008]
PHENOTYPE: Targeted disruption of this gene leads to selective impairment of CD8+ T cell function. Mice homozygous for a knock-out allele exhibit defects in CD8+ T cell-mediated allogenic responses. Mice homozygous for a different knock-out allele show increased resistance to experimentally-induced hepatitis. [provided by MGI curators]
Allele List at MGI

All alleles(7) : Targeted(7)

Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A C 3: 36,875,516 D94A probably damaging Het
Angptl6 G T 9: 20,875,525 Q301K probably damaging Het
Ankfn1 T C 11: 89,453,187 Y323C probably damaging Het
Arid5b T A 10: 68,096,889 H818L possibly damaging Het
Armc4 T C 18: 7,222,550 K573R probably benign Het
Atg13 G T 2: 91,684,765 probably null Het
Bop1 T C 15: 76,455,411 M245V probably benign Het
Ccdc105 A T 10: 78,748,650 L346* probably null Het
Ces2a T A 8: 104,737,409 F224L probably damaging Het
Cntnap5b A G 1: 100,072,201 H228R probably benign Het
Col9a2 A T 4: 121,040,965 R25* probably null Het
Dcaf12 G T 4: 41,302,744 T137N probably benign Het
Dennd4c A G 4: 86,811,456 N765S probably benign Het
Dnah12 A G 14: 26,859,299 Y3162C probably damaging Het
Dpf1 G T 7: 29,311,331 C123F possibly damaging Het
Flvcr1 C A 1: 191,026,009 A29S probably benign Het
Frmd3 A T 4: 74,187,796 I560F probably damaging Het
Galnt15 G A 14: 32,049,843 V282I possibly damaging Het
Gm14412 A T 2: 177,314,612 C497S probably damaging Het
Gm20830 A T Y: 6,916,464 Y218* probably null Het
Hmcn2 C A 2: 31,420,363 T3323N probably damaging Het
Idh1 T A 1: 65,175,336 Q6L probably benign Het
Kansl2-ps A G 7: 72,673,065 noncoding transcript Het
Kcnj10 T A 1: 172,369,480 V187E probably damaging Het
Khnyn A G 14: 55,887,500 T404A probably damaging Het
Lrp1b T A 2: 41,770,868 N76I probably damaging Het
Lrrc9 G A 12: 72,454,088 C196Y probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mgp T A 6: 136,872,774 N62I probably benign Het
Ms4a6c T A 19: 11,471,224 H40Q probably benign Het
Necab3 A G 2: 154,547,459 S121P probably damaging Het
Nfkb1 T A 3: 135,626,611 K128* probably null Het
Nr4a3 A T 4: 48,067,861 R486W probably damaging Het
Nwd2 A G 5: 63,807,648 K1525R probably benign Het
Pbrm1 G T 14: 31,085,011 D1085Y probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rbm15 A G 3: 107,330,467 S872P possibly damaging Het
Retsat A G 6: 72,601,535 I77V probably damaging Het
Rpl32 A G 6: 115,807,035 F77L probably benign Het
Ryr3 A T 2: 112,794,469 V2202D probably damaging Het
Sars2 G A 7: 28,750,291 R387Q probably null Het
Serpinb3d G T 1: 107,078,533 T275N probably benign Het
Sf3a1 C A 11: 4,174,041 P296Q probably damaging Het
Sh3bgr A G 16: 96,224,544 probably benign Het
St3gal3 A G 4: 117,940,050 L332P probably damaging Het
Ston1 A G 17: 88,645,311 probably benign Het
Syne2 T A 12: 75,971,875 S3383T probably damaging Het
Trap1 T C 16: 4,044,665 D583G probably benign Het
Ube2cbp A T 9: 86,427,407 I212N possibly damaging Het
Usp34 T A 11: 23,412,271 D1572E probably damaging Het
Vmn1r179 A T 7: 23,928,962 T193S probably benign Het
Vmn2r111 C A 17: 22,548,489 V676L probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wls C T 3: 159,934,340 R536C probably damaging Het
Zfhx3 A G 8: 108,792,399 D51G probably damaging Het
Other mutations in Tnfsf14
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00676:Tnfsf14 APN 17 57192562 missense possibly damaging 0.89
IGL00962:Tnfsf14 APN 17 57192906 nonsense probably null
IGL02515:Tnfsf14 APN 17 57192600 missense probably benign
P0015:Tnfsf14 UTSW 17 57190815 missense probably damaging 1.00
R1435:Tnfsf14 UTSW 17 57190605 missense possibly damaging 0.60
R1566:Tnfsf14 UTSW 17 57193876 missense probably benign
R1791:Tnfsf14 UTSW 17 57190867 missense probably damaging 1.00
R1967:Tnfsf14 UTSW 17 57190807 missense probably damaging 1.00
R2108:Tnfsf14 UTSW 17 57190867 missense probably damaging 1.00
R2202:Tnfsf14 UTSW 17 57190638 missense possibly damaging 0.67
R2203:Tnfsf14 UTSW 17 57190638 missense possibly damaging 0.67
R2204:Tnfsf14 UTSW 17 57190638 missense possibly damaging 0.67
R2205:Tnfsf14 UTSW 17 57190638 missense possibly damaging 0.67
R2232:Tnfsf14 UTSW 17 57193876 missense probably benign
R4790:Tnfsf14 UTSW 17 57190740 missense probably damaging 1.00
R7474:Tnfsf14 UTSW 17 57190848 missense
Predicted Primers PCR Primer
(F):5'- TGTGTCCCCATGACTAGCAG -3'
(R):5'- AGAAGCAGAAATCTGGGTCC -3'

Sequencing Primer
(F):5'- CACTATGGCATGCACATGTG -3'
(R):5'- TCCAAAAGGGACAGAGCCTGAC -3'
Posted On2016-09-01