Incidental Mutation 'R5434:Armc4'
ID428235
Institutional Source Beutler Lab
Gene Symbol Armc4
Ensembl Gene ENSMUSG00000061802
Gene Namearmadillo repeat containing 4
Synonymsb2b643Clo, 4930463I21Rik, b2b227.1Clo
MMRRC Submission 042999-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R5434 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location7088233-7297901 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 7222550 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 573 (K573R)
Ref Sequence ENSEMBL: ENSMUSP00000080028 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081275]
Predicted Effect probably benign
Transcript: ENSMUST00000081275
AA Change: K573R

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000080028
Gene: ENSMUSG00000061802
AA Change: K573R

DomainStartEndE-ValueType
low complexity region 172 186 N/A INTRINSIC
low complexity region 410 428 N/A INTRINSIC
ARM 475 516 1.38e1 SMART
ARM 517 557 2.38e-2 SMART
ARM 558 613 3.97e0 SMART
ARM 614 654 2.59e-3 SMART
ARM 655 695 3.48e1 SMART
ARM 696 737 1.6e1 SMART
ARM 738 778 4.09e0 SMART
ARM 779 819 9.68e0 SMART
ARM 861 903 3.52e0 SMART
ARM 904 944 1.26e1 SMART
ARM 945 985 1.03e1 SMART
ARM 986 1026 1.13e-3 SMART
Meta Mutation Damage Score 0.018 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (57/57)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains ten Armadillo repeat motifs (ARMs) and one HEAT repeat, and is thought to be involved in ciliary and flagellar movement. This protein has been shown to localize to the ciliary axonemes and at the ciliary base of respiratory cells. Studies indicate that mutations in this gene cause partial outer dynein arm (ODA) defects in respiratory cilia. The cilia of cells with mutations in this gene displayed either reduced ciliary beat frequency and amplitude, or, complete immotility. Some individuals with primary ciliary dyskensia (PCD) have been shown to have mutations in this gene. PCD is characterized by chronic airway disease and left/right body asymmetry defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mice homozygous for ENU-induced mutations exhibit situs inversus totalis or heterotaxia with congenital heart disease including double outlet right ventricle and ventricular septal defects. Dyskinetic, slow, or immotile airway cilia are also observed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 55 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik A C 3: 36,875,516 D94A probably damaging Het
Angptl6 G T 9: 20,875,525 Q301K probably damaging Het
Ankfn1 T C 11: 89,453,187 Y323C probably damaging Het
Arid5b T A 10: 68,096,889 H818L possibly damaging Het
Atg13 G T 2: 91,684,765 probably null Het
Bop1 T C 15: 76,455,411 M245V probably benign Het
Ccdc105 A T 10: 78,748,650 L346* probably null Het
Ces2a T A 8: 104,737,409 F224L probably damaging Het
Cntnap5b A G 1: 100,072,201 H228R probably benign Het
Col9a2 A T 4: 121,040,965 R25* probably null Het
Dcaf12 G T 4: 41,302,744 T137N probably benign Het
Dennd4c A G 4: 86,811,456 N765S probably benign Het
Dnah12 A G 14: 26,859,299 Y3162C probably damaging Het
Dpf1 G T 7: 29,311,331 C123F possibly damaging Het
Flvcr1 C A 1: 191,026,009 A29S probably benign Het
Frmd3 A T 4: 74,187,796 I560F probably damaging Het
Galnt15 G A 14: 32,049,843 V282I possibly damaging Het
Gm14412 A T 2: 177,314,612 C497S probably damaging Het
Gm20830 A T Y: 6,916,464 Y218* probably null Het
Hmcn2 C A 2: 31,420,363 T3323N probably damaging Het
Idh1 T A 1: 65,175,336 Q6L probably benign Het
Kansl2-ps A G 7: 72,673,065 noncoding transcript Het
Kcnj10 T A 1: 172,369,480 V187E probably damaging Het
Khnyn A G 14: 55,887,500 T404A probably damaging Het
Lrp1b T A 2: 41,770,868 N76I probably damaging Het
Lrrc9 G A 12: 72,454,088 C196Y probably damaging Het
Ltbr G A 6: 125,312,794 R146W probably damaging Het
Mgp T A 6: 136,872,774 N62I probably benign Het
Ms4a6c T A 19: 11,471,224 H40Q probably benign Het
Necab3 A G 2: 154,547,459 S121P probably damaging Het
Nfkb1 T A 3: 135,626,611 K128* probably null Het
Nr4a3 A T 4: 48,067,861 R486W probably damaging Het
Nwd2 A G 5: 63,807,648 K1525R probably benign Het
Pbrm1 G T 14: 31,085,011 D1085Y probably damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rbm15 A G 3: 107,330,467 S872P possibly damaging Het
Retsat A G 6: 72,601,535 I77V probably damaging Het
Rpl32 A G 6: 115,807,035 F77L probably benign Het
Ryr3 A T 2: 112,794,469 V2202D probably damaging Het
Sars2 G A 7: 28,750,291 R387Q probably null Het
Serpinb3d G T 1: 107,078,533 T275N probably benign Het
Sf3a1 C A 11: 4,174,041 P296Q probably damaging Het
Sh3bgr A G 16: 96,224,544 probably benign Het
St3gal3 A G 4: 117,940,050 L332P probably damaging Het
Ston1 A G 17: 88,645,311 probably benign Het
Syne2 T A 12: 75,971,875 S3383T probably damaging Het
Tnfsf14 A G 17: 57,192,592 S87P probably benign Het
Trap1 T C 16: 4,044,665 D583G probably benign Het
Ube2cbp A T 9: 86,427,407 I212N possibly damaging Het
Usp34 T A 11: 23,412,271 D1572E probably damaging Het
Vmn1r179 A T 7: 23,928,962 T193S probably benign Het
Vmn2r111 C A 17: 22,548,489 V676L probably damaging Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Wls C T 3: 159,934,340 R536C probably damaging Het
Zfhx3 A G 8: 108,792,399 D51G probably damaging Het
Other mutations in Armc4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00693:Armc4 APN 18 7211504 missense probably damaging 0.96
IGL00822:Armc4 APN 18 7181817 missense probably damaging 1.00
IGL01345:Armc4 APN 18 7266947 missense probably benign 0.00
IGL01593:Armc4 APN 18 7127345 missense probably benign 0.00
IGL01645:Armc4 APN 18 7268491 missense probably benign 0.00
IGL01863:Armc4 APN 18 7222617 missense probably damaging 1.00
IGL01955:Armc4 APN 18 7127291 missense possibly damaging 0.89
IGL02013:Armc4 APN 18 7265157 splice site probably benign
IGL02142:Armc4 APN 18 7214601 missense probably damaging 1.00
IGL02399:Armc4 APN 18 7285719 missense probably benign
IGL02439:Armc4 APN 18 7268444 missense probably benign 0.04
IGL02452:Armc4 APN 18 7129461 missense probably damaging 1.00
IGL02632:Armc4 APN 18 7214727 splice site probably benign
IGL03344:Armc4 APN 18 7129434 nonsense probably null
R0062:Armc4 UTSW 18 7129593 splice site probably benign
R0062:Armc4 UTSW 18 7129593 splice site probably benign
R0242:Armc4 UTSW 18 7211516 missense probably damaging 0.96
R0242:Armc4 UTSW 18 7211516 missense probably damaging 0.96
R0365:Armc4 UTSW 18 7217800 missense probably benign 0.01
R0377:Armc4 UTSW 18 7127415 missense probably benign 0.04
R0466:Armc4 UTSW 18 7286758 missense probably benign 0.10
R0517:Armc4 UTSW 18 7223621 missense probably damaging 1.00
R0521:Armc4 UTSW 18 7222676 missense possibly damaging 0.64
R0841:Armc4 UTSW 18 7268436 missense probably damaging 0.99
R1145:Armc4 UTSW 18 7268436 missense probably damaging 0.99
R1145:Armc4 UTSW 18 7268436 missense probably damaging 0.99
R1435:Armc4 UTSW 18 7222646 missense probably benign 0.01
R1487:Armc4 UTSW 18 7273245 missense probably damaging 0.98
R1634:Armc4 UTSW 18 7286688 missense probably damaging 0.99
R1677:Armc4 UTSW 18 7222554 missense probably benign 0.01
R1778:Armc4 UTSW 18 7127388 missense probably damaging 1.00
R1792:Armc4 UTSW 18 7286743 missense probably benign 0.00
R1809:Armc4 UTSW 18 7211630 missense probably benign 0.08
R1842:Armc4 UTSW 18 7223551 missense probably benign 0.04
R2144:Armc4 UTSW 18 7127229 missense probably damaging 0.96
R2206:Armc4 UTSW 18 7223676 missense probably benign 0.25
R2273:Armc4 UTSW 18 7223676 missense probably benign 0.25
R2275:Armc4 UTSW 18 7223676 missense probably benign 0.25
R2918:Armc4 UTSW 18 7222625 missense probably benign 0.04
R3421:Armc4 UTSW 18 7223523 splice site probably benign
R3422:Armc4 UTSW 18 7223523 splice site probably benign
R4165:Armc4 UTSW 18 7217008 missense probably damaging 1.00
R4225:Armc4 UTSW 18 7181732 critical splice donor site probably null
R4660:Armc4 UTSW 18 7211609 missense possibly damaging 0.88
R4745:Armc4 UTSW 18 7286763 missense probably benign 0.28
R4812:Armc4 UTSW 18 7288634 missense possibly damaging 0.79
R4831:Armc4 UTSW 18 7222564 missense possibly damaging 0.79
R4923:Armc4 UTSW 18 7181787 missense probably damaging 0.97
R4995:Armc4 UTSW 18 7223663 missense probably damaging 1.00
R5024:Armc4 UTSW 18 7088555 missense probably benign 0.02
R5335:Armc4 UTSW 18 7294566 missense probably benign 0.06
R5552:Armc4 UTSW 18 7285360 missense possibly damaging 0.51
R5719:Armc4 UTSW 18 7211496 missense probably benign 0.00
R5736:Armc4 UTSW 18 7268416 missense probably benign 0.01
R5792:Armc4 UTSW 18 7217965 missense probably benign 0.00
R5848:Armc4 UTSW 18 7268507 synonymous probably null
R5957:Armc4 UTSW 18 7285706 missense probably benign 0.01
R6001:Armc4 UTSW 18 7286838 missense probably benign 0.03
R6309:Armc4 UTSW 18 7214617 missense probably benign 0.04
R6559:Armc4 UTSW 18 7223664 missense probably damaging 0.99
R6574:Armc4 UTSW 18 7129394 splice site probably null
R6581:Armc4 UTSW 18 7129560 missense possibly damaging 0.77
R6736:Armc4 UTSW 18 7223586 missense probably damaging 0.98
R6842:Armc4 UTSW 18 7268401 missense probably benign 0.00
R6968:Armc4 UTSW 18 7273155 splice site probably null
R6974:Armc4 UTSW 18 7294479 missense probably benign 0.37
R7024:Armc4 UTSW 18 7211593 missense probably benign 0.43
R7299:Armc4 UTSW 18 7222635 missense probably damaging 1.00
Z1088:Armc4 UTSW 18 7266919 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACATCATTCTTAAAGCCATGTTACA -3'
(R):5'- AAACTCTCAATCATCTGTCACTCC -3'

Sequencing Primer
(F):5'- AAGCCACACATCCTGATG -3'
(R):5'- TCCTGAAGGAAATCAGTCATAATCC -3'
Posted On2016-09-01