Incidental Mutation 'R5435:Scn1a'
ID428242
Institutional Source Beutler Lab
Gene Symbol Scn1a
Ensembl Gene ENSMUSG00000064329
Gene Namesodium channel, voltage-gated, type I, alpha
SynonymsNav1.1
MMRRC Submission 043000-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5435 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location66270778-66440840 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 66273534 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Valine at position 1783 (E1783V)
Ref Sequence ENSEMBL: ENSMUSP00000107990 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077489] [ENSMUST00000094951] [ENSMUST00000112366] [ENSMUST00000112371] [ENSMUST00000156865]
Predicted Effect probably damaging
Transcript: ENSMUST00000077489
AA Change: E1783V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076697
Gene: ENSMUSG00000064329
AA Change: E1783V

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.4e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 708 5.5e-73 PFAM
Pfam:Ion_trans 791 980 6.8e-47 PFAM
Pfam:Na_trans_assoc 995 1217 1.2e-74 PFAM
Pfam:Ion_trans 1243 1471 1.1e-56 PFAM
PDB:1BYY|A 1473 1525 4e-31 PDB
Pfam:Ion_trans 1564 1774 1.1e-51 PFAM
Pfam:PKD_channel 1623 1781 3.9e-7 PFAM
low complexity region 1826 1838 N/A INTRINSIC
IQ 1903 1925 1.65e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000094951
AA Change: E1766V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000092558
Gene: ENSMUSG00000064329
AA Change: E1766V

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.3e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 691 2e-62 PFAM
Pfam:Ion_trans 774 963 6.7e-47 PFAM
Pfam:Na_trans_assoc 978 1200 1.2e-74 PFAM
Pfam:Ion_trans 1226 1454 1e-56 PFAM
PDB:1BYY|A 1456 1508 4e-31 PDB
Pfam:Ion_trans 1547 1757 1.1e-51 PFAM
Pfam:PKD_channel 1606 1764 3.8e-7 PFAM
low complexity region 1809 1821 N/A INTRINSIC
IQ 1886 1908 1.65e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112366
AA Change: E1794V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107985
Gene: ENSMUSG00000064329
AA Change: E1794V

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 127 434 2.8e-82 PFAM
Pfam:Na_trans_cytopl 502 718 2e-91 PFAM
Pfam:Ion_trans 767 1002 6.5e-57 PFAM
Pfam:Na_trans_assoc 1006 1213 1.2e-60 PFAM
Pfam:Ion_trans 1217 1493 3.3e-67 PFAM
Pfam:Ion_trans 1540 1797 6.3e-56 PFAM
Pfam:PKD_channel 1637 1791 1.1e-6 PFAM
low complexity region 1837 1849 N/A INTRINSIC
IQ 1914 1936 1.65e-2 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112371
AA Change: E1783V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107990
Gene: ENSMUSG00000064329
AA Change: E1783V

DomainStartEndE-ValueType
low complexity region 23 52 N/A INTRINSIC
Pfam:Ion_trans 156 422 5.4e-77 PFAM
low complexity region 431 466 N/A INTRINSIC
Pfam:DUF3451 484 708 5.5e-73 PFAM
Pfam:Ion_trans 791 980 6.8e-47 PFAM
Pfam:Na_trans_assoc 995 1217 1.2e-74 PFAM
Pfam:Ion_trans 1243 1471 1.1e-56 PFAM
PDB:1BYY|A 1473 1525 4e-31 PDB
Pfam:Ion_trans 1564 1774 1.1e-51 PFAM
Pfam:PKD_channel 1623 1781 3.9e-7 PFAM
low complexity region 1826 1838 N/A INTRINSIC
IQ 1903 1925 1.65e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000156865
SMART Domains Protein: ENSMUSP00000144633
Gene: ENSMUSG00000064329

DomainStartEndE-ValueType
Pfam:Na_trans_assoc 1 182 2.2e-44 PFAM
Pfam:Ion_trans 186 462 1.3e-66 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000200839
Meta Mutation Damage Score 0.6356 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-dependent sodium channels are heteromeric complexes that regulate sodium exchange between intracellular and extracellular spaces and are essential for the generation and propagation of action potentials in muscle cells and neurons. Each sodium channel is composed of a large pore-forming, glycosylated alpha subunit and two smaller beta subunits. This gene encodes a sodium channel alpha subunit, which has four homologous domains, each of which contains six transmembrane regions. Allelic variants of this gene are associated with generalized epilepsy with febrile seizures and epileptic encephalopathy. Alternative splicing results in multiple transcript variants. The RefSeq Project has decided to create four representative RefSeq records. Three of the transcript variants are supported by experimental evidence and the fourth contains alternate 5' untranslated exons, the exact combination of which have not been experimentally confirmed for the full-length transcript. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous null mice show postnatal lethality, seizures and behavioral deficits whereas heterozygotes die prematurely with seizures and abnormal electrophysiology. In addition, knock-in mice exhibit increased susceptibility to febrile and flurothyl-induced seizures, and reduced inhibitory signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,741,250 probably benign Het
3425401B19Rik A G 14: 32,661,456 F851L probably benign Het
Abca17 C T 17: 24,267,614 V1480I possibly damaging Het
Acsbg1 G T 9: 54,615,869 Y491* probably null Het
Acsf3 T A 8: 122,780,281 N104K probably damaging Het
Adam23 T C 1: 63,546,453 Y400H possibly damaging Het
Adgra3 G A 5: 49,990,126 T524M probably damaging Het
Aff1 G A 5: 103,754,332 probably benign Het
Anxa9 T C 3: 95,297,250 Y321C probably damaging Het
Ap1g1 T A 8: 109,838,920 Y329N probably damaging Het
Aph1c A T 9: 66,834,501 I33N possibly damaging Het
B3galnt2 A G 13: 13,996,990 E491G probably benign Het
Bdh1 C T 16: 31,456,657 R235C probably damaging Het
Ccar2 A G 14: 70,139,327 L856P probably damaging Het
Ccdc107 A T 4: 43,493,519 D30V probably damaging Het
Ccdc116 G T 16: 17,142,762 H64N probably benign Het
Ccl12 T C 11: 82,103,175 I86T possibly damaging Het
Col2a1 T C 15: 98,000,510 probably benign Het
Col4a4 T A 1: 82,454,007 I1519F unknown Het
Ddx19b T C 8: 111,008,826 Q416R possibly damaging Het
Dnah6 T A 6: 73,060,138 M3374L probably benign Het
Dnajc6 A T 4: 101,606,610 I119F probably damaging Het
Ensa C A 3: 95,622,458 probably benign Het
Fbxo4 C T 15: 3,965,792 V357I possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Foxf1 G A 8: 121,084,492 G32S probably damaging Het
Gls2 G A 10: 128,195,126 probably benign Het
Gm13599 T A 2: 67,396,152 noncoding transcript Het
Gmnn A G 13: 24,752,101 S197P probably benign Het
Guf1 A T 5: 69,563,169 H324L probably benign Het
H2-Q6 A G 17: 35,425,685 D150G probably damaging Het
Herc3 T A 6: 58,855,806 L152Q probably damaging Het
Hnrnpul2 T G 19: 8,820,318 S13A probably benign Het
Ighv5-4 A G 12: 113,597,663 F46L probably benign Het
Kank1 T G 19: 25,411,143 S727A probably benign Het
Kcnma1 A T 14: 23,528,404 Y201* probably null Het
Lyst A T 13: 13,777,064 H3750L possibly damaging Het
Mettl25 A G 10: 105,779,586 probably null Het
Mpdz A G 4: 81,283,487 probably benign Het
Myh9 C T 15: 77,769,609 V1280I probably benign Het
Neto1 A T 18: 86,398,263 T32S probably benign Het
Nol7 C A 13: 43,401,372 H187Q possibly damaging Het
Olfr992 T A 2: 85,400,470 N21I probably benign Het
Pcdha8 A G 18: 36,993,599 D378G probably damaging Het
Peak1 A G 9: 56,206,486 S694P probably damaging Het
Pih1d1 T A 7: 45,156,272 probably null Het
Pik3c2g T G 6: 139,715,855 probably null Het
Prkar2a A G 9: 108,740,483 R247G probably damaging Het
Psg26 A G 7: 18,478,473 I319T possibly damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa3 T C 8: 13,631,811 E46G possibly damaging Het
Rbbp5 T A 1: 132,494,275 H304Q probably damaging Het
Stag1 A G 9: 100,953,550 N151S probably benign Het
Tbc1d32 C A 10: 56,040,150 A1191S probably damaging Het
Tchh C A 3: 93,443,672 R140S possibly damaging Het
Trank1 A G 9: 111,391,890 Y2565C probably benign Het
Ttn A T 2: 76,914,358 V5449D probably damaging Het
Tubgcp2 G A 7: 139,996,072 P893S possibly damaging Het
Wdfy4 A G 14: 33,020,311 F2325S probably damaging Het
Wdr35 A G 12: 8,989,951 D352G probably benign Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Ypel3 A G 7: 126,775,788 probably benign Het
Zan T A 5: 137,403,762 T4023S unknown Het
Zfp735 T A 11: 73,712,113 C628S possibly damaging Het
Other mutations in Scn1a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00513:Scn1a APN 2 66335531 critical splice acceptor site probably null
IGL00650:Scn1a APN 2 66280793 missense probably damaging 1.00
IGL00658:Scn1a APN 2 66286038 missense probably damaging 1.00
IGL00823:Scn1a APN 2 66324935 missense probably benign 0.04
IGL00907:Scn1a APN 2 66327797 missense probably damaging 1.00
IGL01339:Scn1a APN 2 66325960 missense probably benign 0.09
IGL01401:Scn1a APN 2 66289111 missense probably damaging 1.00
IGL01503:Scn1a APN 2 66322343 missense probably damaging 1.00
IGL01575:Scn1a APN 2 66273236 missense probably damaging 1.00
IGL01598:Scn1a APN 2 66302485 missense possibly damaging 0.63
IGL01613:Scn1a APN 2 66285937 missense probably damaging 1.00
IGL01796:Scn1a APN 2 66332301 splice site probably benign
IGL02079:Scn1a APN 2 66323360 missense probably benign 0.14
IGL02171:Scn1a APN 2 66273199 missense probably damaging 1.00
IGL02335:Scn1a APN 2 66277661 missense possibly damaging 0.93
IGL02406:Scn1a APN 2 66326036 missense possibly damaging 0.88
IGL02436:Scn1a APN 2 66351153 missense probably benign 0.01
IGL02507:Scn1a APN 2 66277813 missense probably damaging 1.00
IGL02646:Scn1a APN 2 66299618 splice site probably null
IGL02729:Scn1a APN 2 66299650 missense probably damaging 1.00
IGL02740:Scn1a APN 2 66324762 missense probably damaging 1.00
IGL02740:Scn1a APN 2 66318077 missense probably benign 0.00
IGL02752:Scn1a APN 2 66331412 missense probably damaging 1.00
IGL02815:Scn1a APN 2 66324858 missense probably damaging 1.00
IGL03163:Scn1a APN 2 66318074 missense probably benign 0.00
IGL03229:Scn1a APN 2 66299713 missense probably damaging 1.00
IGL03286:Scn1a APN 2 66277576 missense probably damaging 0.99
IGL03393:Scn1a APN 2 66318018 missense probably benign 0.19
PIT4791001:Scn1a UTSW 2 66273282 missense probably benign 0.18
R0053:Scn1a UTSW 2 66299775 missense probably benign 0.05
R0053:Scn1a UTSW 2 66299775 missense probably benign 0.05
R0107:Scn1a UTSW 2 66324633 missense probably benign 0.07
R0141:Scn1a UTSW 2 66289062 missense probably damaging 1.00
R0485:Scn1a UTSW 2 66273925 missense probably damaging 0.98
R0517:Scn1a UTSW 2 66302407 missense possibly damaging 0.88
R0532:Scn1a UTSW 2 66317823 missense probably damaging 1.00
R0746:Scn1a UTSW 2 66351126 missense probably benign 0.25
R0755:Scn1a UTSW 2 66321035 missense probably damaging 1.00
R0830:Scn1a UTSW 2 66299784 missense probably damaging 1.00
R0846:Scn1a UTSW 2 66324755 missense probably benign 0.43
R0918:Scn1a UTSW 2 66323307 splice site probably null
R1055:Scn1a UTSW 2 66337996 missense probably benign 0.08
R1432:Scn1a UTSW 2 66322429 missense probably damaging 1.00
R1497:Scn1a UTSW 2 66332287 missense probably damaging 1.00
R1512:Scn1a UTSW 2 66331285 missense possibly damaging 0.82
R1525:Scn1a UTSW 2 66319462 nonsense probably null
R1567:Scn1a UTSW 2 66273331 missense probably damaging 1.00
R1702:Scn1a UTSW 2 66318223 missense probably damaging 1.00
R1744:Scn1a UTSW 2 66322276 missense probably benign 0.06
R1834:Scn1a UTSW 2 66324616 missense probably benign 0.04
R1834:Scn1a UTSW 2 66324617 missense probably benign 0.00
R1860:Scn1a UTSW 2 66317982 missense probably damaging 0.99
R1871:Scn1a UTSW 2 66318025 missense probably damaging 0.98
R1909:Scn1a UTSW 2 66331352 missense possibly damaging 0.58
R1967:Scn1a UTSW 2 66328425 missense probably damaging 1.00
R1976:Scn1a UTSW 2 66331271 missense probably benign 0.02
R2291:Scn1a UTSW 2 66288968 missense probably benign 0.44
R2302:Scn1a UTSW 2 66277745 missense probably damaging 1.00
R2367:Scn1a UTSW 2 66327679 missense probably damaging 1.00
R2418:Scn1a UTSW 2 66273843 missense probably damaging 0.98
R2517:Scn1a UTSW 2 66273832 missense probably damaging 1.00
R2568:Scn1a UTSW 2 66273469 missense probably damaging 1.00
R3083:Scn1a UTSW 2 66299637 missense probably damaging 1.00
R3903:Scn1a UTSW 2 66318132 missense probably benign 0.08
R3909:Scn1a UTSW 2 66273988 missense probably damaging 1.00
R3916:Scn1a UTSW 2 66277613 missense probably damaging 1.00
R3935:Scn1a UTSW 2 66327776 missense probably damaging 0.99
R3936:Scn1a UTSW 2 66327776 missense probably damaging 0.99
R4043:Scn1a UTSW 2 66326036 missense possibly damaging 0.60
R4429:Scn1a UTSW 2 66350985 missense possibly damaging 0.77
R4495:Scn1a UTSW 2 66280802 critical splice acceptor site probably null
R4662:Scn1a UTSW 2 66350988 missense probably benign 0.23
R4834:Scn1a UTSW 2 66328522 nonsense probably null
R4873:Scn1a UTSW 2 66328476 missense possibly damaging 0.92
R4875:Scn1a UTSW 2 66328476 missense possibly damaging 0.92
R5099:Scn1a UTSW 2 66277801 missense probably damaging 1.00
R5255:Scn1a UTSW 2 66277669 missense probably damaging 0.99
R5449:Scn1a UTSW 2 66321002 missense probably damaging 0.96
R5519:Scn1a UTSW 2 66332213 missense probably damaging 1.00
R5541:Scn1a UTSW 2 66324633 missense probably benign 0.07
R5556:Scn1a UTSW 2 66324797 missense probably benign 0.00
R5587:Scn1a UTSW 2 66273081 missense probably benign 0.01
R5972:Scn1a UTSW 2 66351110 missense possibly damaging 0.65
R5992:Scn1a UTSW 2 66335456 missense probably damaging 1.00
R6195:Scn1a UTSW 2 66277618 missense possibly damaging 0.59
R6233:Scn1a UTSW 2 66277618 missense possibly damaging 0.59
R6328:Scn1a UTSW 2 66273316 missense probably damaging 1.00
R6417:Scn1a UTSW 2 66273198 missense probably damaging 1.00
R6420:Scn1a UTSW 2 66273198 missense probably damaging 1.00
R6421:Scn1a UTSW 2 66272927 missense probably damaging 1.00
R6461:Scn1a UTSW 2 66326122 missense probably null 0.01
R6701:Scn1a UTSW 2 66337960 missense probably damaging 0.99
R6717:Scn1a UTSW 2 66332287 missense probably damaging 1.00
R6834:Scn1a UTSW 2 66327742 missense probably damaging 1.00
R6918:Scn1a UTSW 2 66332213 missense probably damaging 1.00
R6953:Scn1a UTSW 2 66319469 missense probably damaging 1.00
R6996:Scn1a UTSW 2 66287731 missense probably damaging 1.00
R7022:Scn1a UTSW 2 66317899 missense probably damaging 1.00
R7109:Scn1a UTSW 2 66350942 missense possibly damaging 0.62
R7115:Scn1a UTSW 2 66324618 nonsense probably null
R7239:Scn1a UTSW 2 66277656 intron probably null
R7434:Scn1a UTSW 2 66273045 missense probably benign
Predicted Primers PCR Primer
(F):5'- CATGGCAATGAGCTGAAGTTTG -3'
(R):5'- TGCCTGTTCCAAATCACCAC -3'

Sequencing Primer
(F):5'- GCAATGAGCTGAAGTTTGTTTGG -3'
(R):5'- AATCACCACCTCTGCGGG -3'
Posted On2016-09-01