Incidental Mutation 'R5435:Mpdz'
ID428250
Institutional Source Beutler Lab
Gene Symbol Mpdz
Ensembl Gene ENSMUSG00000028402
Gene Namemultiple PDZ domain protein
SynonymsB930003D11Rik, MUPP1
MMRRC Submission 043000-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5435 (G1)
Quality Score134
Status Validated
Chromosome4
Chromosomal Location81278500-81442815 bp(-) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to G at 81283487 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000152533 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102830] [ENSMUST00000107258] [ENSMUST00000107262] [ENSMUST00000131547] [ENSMUST00000134726] [ENSMUST00000220807]
Predicted Effect probably benign
Transcript: ENSMUST00000102830
SMART Domains Protein: ENSMUSP00000099894
Gene: ENSMUSG00000028402

DomainStartEndE-ValueType
L27 6 66 9.04e-3 SMART
PDZ 147 225 3.03e-23 SMART
PDZ 266 338 8.92e-21 SMART
low complexity region 345 360 N/A INTRINSIC
PDZ 386 464 6.07e-23 SMART
PDZ 556 627 7.31e-17 SMART
PDZ 701 780 9.94e-19 SMART
PDZ 1004 1080 3.44e-13 SMART
low complexity region 1111 1126 N/A INTRINSIC
PDZ 1148 1231 2.43e-22 SMART
low complexity region 1233 1251 N/A INTRINSIC
PDZ 1346 1421 3.41e-17 SMART
low complexity region 1434 1445 N/A INTRINSIC
low complexity region 1454 1468 N/A INTRINSIC
PDZ 1479 1552 2.69e-15 SMART
PDZ 1622 1697 3.2e-22 SMART
PDZ 1719 1792 3.62e-21 SMART
low complexity region 1798 1815 N/A INTRINSIC
PDZ 1856 1933 9.79e-18 SMART
PDZ 1980 2055 2.39e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107258
SMART Domains Protein: ENSMUSP00000102879
Gene: ENSMUSG00000028402

DomainStartEndE-ValueType
PDZ 1 73 3.42e-8 SMART
low complexity region 104 119 N/A INTRINSIC
PDZ 141 224 2.43e-22 SMART
PDZ 306 381 3.41e-17 SMART
low complexity region 394 405 N/A INTRINSIC
low complexity region 414 428 N/A INTRINSIC
PDZ 439 512 2.69e-15 SMART
PDZ 582 657 3.2e-22 SMART
PDZ 679 752 3.62e-21 SMART
low complexity region 758 775 N/A INTRINSIC
PDZ 816 893 9.79e-18 SMART
PDZ 940 1015 2.39e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000107262
SMART Domains Protein: ENSMUSP00000102883
Gene: ENSMUSG00000028402

DomainStartEndE-ValueType
L27 6 66 9.04e-3 SMART
PDZ 147 225 3.03e-23 SMART
PDZ 266 338 8.92e-21 SMART
low complexity region 345 360 N/A INTRINSIC
PDZ 386 464 6.07e-23 SMART
PDZ 556 627 7.31e-17 SMART
PDZ 701 780 9.94e-19 SMART
PDZ 1004 1080 3.44e-13 SMART
low complexity region 1112 1127 N/A INTRINSIC
PDZ 1149 1232 2.43e-22 SMART
low complexity region 1234 1252 N/A INTRINSIC
PDZ 1347 1422 3.41e-17 SMART
low complexity region 1435 1446 N/A INTRINSIC
low complexity region 1455 1469 N/A INTRINSIC
PDZ 1480 1553 2.69e-15 SMART
PDZ 1623 1698 3.2e-22 SMART
PDZ 1720 1793 3.62e-21 SMART
low complexity region 1799 1816 N/A INTRINSIC
PDZ 1857 1934 9.79e-18 SMART
PDZ 1981 2056 2.39e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124805
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131418
Predicted Effect probably benign
Transcript: ENSMUST00000131547
SMART Domains Protein: ENSMUSP00000116767
Gene: ENSMUSG00000028402

DomainStartEndE-ValueType
Blast:PDZ 1 33 8e-15 BLAST
PDB:2OPG|B 1 37 1e-19 PDB
PDZ 55 128 3.62e-21 SMART
low complexity region 134 151 N/A INTRINSIC
Blast:PDZ 167 209 1e-11 BLAST
PDB:2IWP|B 173 209 3e-6 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000134726
SMART Domains Protein: ENSMUSP00000116830
Gene: ENSMUSG00000028402

DomainStartEndE-ValueType
PDZ 90 137 7.6e0 SMART
PDZ 159 232 3.62e-21 SMART
low complexity region 238 255 N/A INTRINSIC
PDZ 296 373 9.79e-18 SMART
PDZ 420 495 2.39e-21 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156441
Predicted Effect probably benign
Transcript: ENSMUST00000220807
Meta Mutation Damage Score 0.0592 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has multiple PDZ domains, which are hallmarks of protein-protein interactions. The encoded protein is known to interact with the HTR2C receptor and may cause it to clump at the cell surface. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2015]
PHENOTYPE: Mutant heterozygous mice are more sensitive to ethanol withdrawal effects and consume less alcohol than controls. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,741,250 probably benign Het
3425401B19Rik A G 14: 32,661,456 F851L probably benign Het
Abca17 C T 17: 24,267,614 V1480I possibly damaging Het
Acsbg1 G T 9: 54,615,869 Y491* probably null Het
Acsf3 T A 8: 122,780,281 N104K probably damaging Het
Adam23 T C 1: 63,546,453 Y400H possibly damaging Het
Adgra3 G A 5: 49,990,126 T524M probably damaging Het
Aff1 G A 5: 103,754,332 probably benign Het
Anxa9 T C 3: 95,297,250 Y321C probably damaging Het
Ap1g1 T A 8: 109,838,920 Y329N probably damaging Het
Aph1c A T 9: 66,834,501 I33N possibly damaging Het
B3galnt2 A G 13: 13,996,990 E491G probably benign Het
Bdh1 C T 16: 31,456,657 R235C probably damaging Het
Ccar2 A G 14: 70,139,327 L856P probably damaging Het
Ccdc107 A T 4: 43,493,519 D30V probably damaging Het
Ccdc116 G T 16: 17,142,762 H64N probably benign Het
Ccl12 T C 11: 82,103,175 I86T possibly damaging Het
Col2a1 T C 15: 98,000,510 probably benign Het
Col4a4 T A 1: 82,454,007 I1519F unknown Het
Ddx19b T C 8: 111,008,826 Q416R possibly damaging Het
Dnah6 T A 6: 73,060,138 M3374L probably benign Het
Dnajc6 A T 4: 101,606,610 I119F probably damaging Het
Ensa C A 3: 95,622,458 probably benign Het
Fbxo4 C T 15: 3,965,792 V357I possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Foxf1 G A 8: 121,084,492 G32S probably damaging Het
Gls2 G A 10: 128,195,126 probably benign Het
Gm13599 T A 2: 67,396,152 noncoding transcript Het
Gmnn A G 13: 24,752,101 S197P probably benign Het
Guf1 A T 5: 69,563,169 H324L probably benign Het
H2-Q6 A G 17: 35,425,685 D150G probably damaging Het
Herc3 T A 6: 58,855,806 L152Q probably damaging Het
Hnrnpul2 T G 19: 8,820,318 S13A probably benign Het
Ighv5-4 A G 12: 113,597,663 F46L probably benign Het
Kank1 T G 19: 25,411,143 S727A probably benign Het
Kcnma1 A T 14: 23,528,404 Y201* probably null Het
Lyst A T 13: 13,777,064 H3750L possibly damaging Het
Mettl25 A G 10: 105,779,586 probably null Het
Myh9 C T 15: 77,769,609 V1280I probably benign Het
Neto1 A T 18: 86,398,263 T32S probably benign Het
Nol7 C A 13: 43,401,372 H187Q possibly damaging Het
Olfr992 T A 2: 85,400,470 N21I probably benign Het
Pcdha8 A G 18: 36,993,599 D378G probably damaging Het
Peak1 A G 9: 56,206,486 S694P probably damaging Het
Pih1d1 T A 7: 45,156,272 probably null Het
Pik3c2g T G 6: 139,715,855 probably null Het
Prkar2a A G 9: 108,740,483 R247G probably damaging Het
Psg26 A G 7: 18,478,473 I319T possibly damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa3 T C 8: 13,631,811 E46G possibly damaging Het
Rbbp5 T A 1: 132,494,275 H304Q probably damaging Het
Scn1a T A 2: 66,273,534 E1783V probably damaging Het
Stag1 A G 9: 100,953,550 N151S probably benign Het
Tbc1d32 C A 10: 56,040,150 A1191S probably damaging Het
Tchh C A 3: 93,443,672 R140S possibly damaging Het
Trank1 A G 9: 111,391,890 Y2565C probably benign Het
Ttn A T 2: 76,914,358 V5449D probably damaging Het
Tubgcp2 G A 7: 139,996,072 P893S possibly damaging Het
Wdfy4 A G 14: 33,020,311 F2325S probably damaging Het
Wdr35 A G 12: 8,989,951 D352G probably benign Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Ypel3 A G 7: 126,775,788 probably benign Het
Zan T A 5: 137,403,762 T4023S unknown Het
Zfp735 T A 11: 73,712,113 C628S possibly damaging Het
Other mutations in Mpdz
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00229:Mpdz APN 4 81310224 nonsense probably null
IGL00325:Mpdz APN 4 81317631 missense probably damaging 1.00
IGL00497:Mpdz APN 4 81335742 missense probably benign 0.30
IGL00502:Mpdz APN 4 81369723 missense probably damaging 1.00
IGL00539:Mpdz APN 4 81361351 missense possibly damaging 0.83
IGL00938:Mpdz APN 4 81292512 missense probably damaging 1.00
IGL00990:Mpdz APN 4 81303584 splice site probably benign
IGL01394:Mpdz APN 4 81292491 missense possibly damaging 0.92
IGL01537:Mpdz APN 4 81369658 missense probably damaging 0.98
IGL01558:Mpdz APN 4 81295530 nonsense probably null
IGL01561:Mpdz APN 4 81284614 missense probably damaging 1.00
IGL01649:Mpdz APN 4 81303633 missense probably damaging 0.98
IGL01743:Mpdz APN 4 81317682 missense probably damaging 1.00
IGL01941:Mpdz APN 4 81286387 missense possibly damaging 0.91
IGL01969:Mpdz APN 4 81358724 missense probably damaging 0.98
IGL02023:Mpdz APN 4 81329529 missense probably damaging 0.99
IGL02081:Mpdz APN 4 81335869 missense probably damaging 1.00
IGL02304:Mpdz APN 4 81310157 missense possibly damaging 0.78
IGL02304:Mpdz APN 4 81297559 splice site probably benign
IGL02410:Mpdz APN 4 81297493 missense probably benign 0.13
IGL02449:Mpdz APN 4 81329422 splice site probably null
IGL02671:Mpdz APN 4 81290273 missense probably damaging 1.00
IGL02708:Mpdz APN 4 81284571 splice site probably null
IGL02718:Mpdz APN 4 81385202 missense probably damaging 1.00
IGL03065:Mpdz APN 4 81292565 missense probably damaging 0.98
IGL03378:Mpdz APN 4 81419048 splice site probably benign
PIT4458001:Mpdz UTSW 4 81419026 missense probably damaging 1.00
R0108:Mpdz UTSW 4 81381805 missense probably damaging 1.00
R0108:Mpdz UTSW 4 81381805 missense probably damaging 1.00
R0119:Mpdz UTSW 4 81292531 missense probably benign 0.44
R0402:Mpdz UTSW 4 81361440 missense possibly damaging 0.51
R0499:Mpdz UTSW 4 81292531 missense probably benign 0.44
R0718:Mpdz UTSW 4 81292473 missense possibly damaging 0.79
R0844:Mpdz UTSW 4 81421194 start gained probably benign
R0883:Mpdz UTSW 4 81359991 splice site probably benign
R0885:Mpdz UTSW 4 81369592 missense probably benign 0.04
R1344:Mpdz UTSW 4 81308319 missense probably benign 0.01
R1432:Mpdz UTSW 4 81292551 missense probably damaging 1.00
R1488:Mpdz UTSW 4 81348708 nonsense probably null
R1589:Mpdz UTSW 4 81421176 missense probably benign 0.00
R1756:Mpdz UTSW 4 81306877 missense possibly damaging 0.87
R1940:Mpdz UTSW 4 81361443 missense probably benign 0.01
R2068:Mpdz UTSW 4 81335830 missense probably null 1.00
R2182:Mpdz UTSW 4 81348722 missense probably damaging 1.00
R2213:Mpdz UTSW 4 81310172 missense probably damaging 0.99
R2265:Mpdz UTSW 4 81383391 missense probably damaging 1.00
R2268:Mpdz UTSW 4 81383391 missense probably damaging 1.00
R2269:Mpdz UTSW 4 81383391 missense probably damaging 1.00
R3082:Mpdz UTSW 4 81285458 splice site probably benign
R3746:Mpdz UTSW 4 81363147 missense probably damaging 1.00
R3902:Mpdz UTSW 4 81307116 missense probably damaging 1.00
R4095:Mpdz UTSW 4 81383823 missense possibly damaging 0.77
R4097:Mpdz UTSW 4 81335700 missense probably damaging 1.00
R4206:Mpdz UTSW 4 81381762 missense probably benign 0.13
R4675:Mpdz UTSW 4 81383812 missense probably damaging 0.98
R4884:Mpdz UTSW 4 81361476 missense probably damaging 0.97
R5044:Mpdz UTSW 4 81381697 missense probably benign 0.16
R5050:Mpdz UTSW 4 81295448 missense probably benign 0.00
R5243:Mpdz UTSW 4 81306879 missense probably damaging 1.00
R5332:Mpdz UTSW 4 81292580 missense probably damaging 1.00
R5720:Mpdz UTSW 4 81287694 missense probably damaging 0.99
R5743:Mpdz UTSW 4 81421188 start codon destroyed probably null 0.30
R5764:Mpdz UTSW 4 81356446 missense probably benign 0.13
R5876:Mpdz UTSW 4 81285474 nonsense probably null
R5938:Mpdz UTSW 4 81284614 missense probably damaging 1.00
R5988:Mpdz UTSW 4 81284575 critical splice donor site probably null
R6125:Mpdz UTSW 4 81297527 missense probably benign 0.00
R6178:Mpdz UTSW 4 81308365 missense probably damaging 1.00
R6235:Mpdz UTSW 4 81385281 missense probably damaging 1.00
R6293:Mpdz UTSW 4 81360056 missense probably damaging 1.00
R6387:Mpdz UTSW 4 81381709 missense possibly damaging 0.69
R6488:Mpdz UTSW 4 81287733 missense probably benign 0.11
R6536:Mpdz UTSW 4 81383417 missense probably damaging 1.00
R6673:Mpdz UTSW 4 81356430 missense probably benign 0.11
R6879:Mpdz UTSW 4 81348656 missense possibly damaging 0.81
R7180:Mpdz UTSW 4 81335751 missense probably damaging 0.98
R7199:Mpdz UTSW 4 81297333 missense probably damaging 0.98
R7209:Mpdz UTSW 4 81306877 missense possibly damaging 0.87
R7359:Mpdz UTSW 4 81356395 missense probably benign 0.01
X0011:Mpdz UTSW 4 81292759 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGTGTCCTCAGGCTACCTAC -3'
(R):5'- ATCTTTCCCAGGAGAAAGAAGG -3'

Sequencing Primer
(F):5'- AGGCTACCTACCTTGTGAACAGTG -3'
(R):5'- CCCAGGAGAAAGAAGGACCGG -3'
Posted On2016-09-01