Incidental Mutation 'R5435:Ddx19b'
ID428265
Institutional Source Beutler Lab
Gene Symbol Ddx19b
Ensembl Gene ENSMUSG00000033658
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 19b
Synonyms
MMRRC Submission 043000-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.274) question?
Stock #R5435 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location111003188-111031751 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 111008826 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Arginine at position 416 (Q416R)
Ref Sequence ENSEMBL: ENSMUSP00000066806 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000040241] [ENSMUST00000065784]
Predicted Effect probably benign
Transcript: ENSMUST00000040241
AA Change: Q401R

PolyPhen 2 Score 0.395 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000038551
Gene: ENSMUSG00000033658
AA Change: Q401R

DomainStartEndE-ValueType
Blast:DEXDc 5 44 1e-12 BLAST
low complexity region 45 55 N/A INTRINSIC
Blast:DEXDc 57 99 4e-11 BLAST
DEXDc 111 310 2.94e-42 SMART
HELICc 347 434 2.59e-29 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000065784
AA Change: Q416R

PolyPhen 2 Score 0.672 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000066806
Gene: ENSMUSG00000033658
AA Change: Q416R

DomainStartEndE-ValueType
low complexity region 12 25 N/A INTRINSIC
low complexity region 60 70 N/A INTRINSIC
Blast:DEXDc 72 114 5e-11 BLAST
DEXDc 126 325 2.94e-42 SMART
HELICc 362 449 2.59e-29 SMART
Meta Mutation Damage Score 0.22 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases. They are implicated in a number of cellular processes involving alteration of RNA secondary structure such as translation initiation, nuclear and mitochondrial splicing, and ribosome and spliceosome assembly. Based on their distribution patterns, some members of this family are believed to be involved in embryogenesis, spermatogenesis, and cellular growth and division. This gene encodes a DEAD box protein, which exhibits RNA-dependent ATPase and ATP-dependent RNA-unwinding activities. This protein is recruited to the cytoplasmic fibrils of the nuclear pore complex, where it participates in the export of mRNA from the nucleus. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,741,250 probably benign Het
3425401B19Rik A G 14: 32,661,456 F851L probably benign Het
Abca17 C T 17: 24,267,614 V1480I possibly damaging Het
Acsbg1 G T 9: 54,615,869 Y491* probably null Het
Acsf3 T A 8: 122,780,281 N104K probably damaging Het
Adam23 T C 1: 63,546,453 Y400H possibly damaging Het
Adgra3 G A 5: 49,990,126 T524M probably damaging Het
Aff1 G A 5: 103,754,332 probably benign Het
Anxa9 T C 3: 95,297,250 Y321C probably damaging Het
Ap1g1 T A 8: 109,838,920 Y329N probably damaging Het
Aph1c A T 9: 66,834,501 I33N possibly damaging Het
B3galnt2 A G 13: 13,996,990 E491G probably benign Het
Bdh1 C T 16: 31,456,657 R235C probably damaging Het
Ccar2 A G 14: 70,139,327 L856P probably damaging Het
Ccdc107 A T 4: 43,493,519 D30V probably damaging Het
Ccdc116 G T 16: 17,142,762 H64N probably benign Het
Ccl12 T C 11: 82,103,175 I86T possibly damaging Het
Col2a1 T C 15: 98,000,510 probably benign Het
Col4a4 T A 1: 82,454,007 I1519F unknown Het
Dnah6 T A 6: 73,060,138 M3374L probably benign Het
Dnajc6 A T 4: 101,606,610 I119F probably damaging Het
Ensa C A 3: 95,622,458 probably benign Het
Fbxo4 C T 15: 3,965,792 V357I possibly damaging Het
Fkbpl G A 17: 34,645,329 A24T probably benign Het
Foxf1 G A 8: 121,084,492 G32S probably damaging Het
Gls2 G A 10: 128,195,126 probably benign Het
Gm13599 T A 2: 67,396,152 noncoding transcript Het
Gmnn A G 13: 24,752,101 S197P probably benign Het
Guf1 A T 5: 69,563,169 H324L probably benign Het
H2-Q6 A G 17: 35,425,685 D150G probably damaging Het
Herc3 T A 6: 58,855,806 L152Q probably damaging Het
Hnrnpul2 T G 19: 8,820,318 S13A probably benign Het
Ighv5-4 A G 12: 113,597,663 F46L probably benign Het
Kank1 T G 19: 25,411,143 S727A probably benign Het
Kcnma1 A T 14: 23,528,404 Y201* probably null Het
Lyst A T 13: 13,777,064 H3750L possibly damaging Het
Mettl25 A G 10: 105,779,586 probably null Het
Mpdz A G 4: 81,283,487 probably benign Het
Myh9 C T 15: 77,769,609 V1280I probably benign Het
Neto1 A T 18: 86,398,263 T32S probably benign Het
Nol7 C A 13: 43,401,372 H187Q possibly damaging Het
Olfr992 T A 2: 85,400,470 N21I probably benign Het
Pcdha8 A G 18: 36,993,599 D378G probably damaging Het
Peak1 A G 9: 56,206,486 S694P probably damaging Het
Pih1d1 T A 7: 45,156,272 probably null Het
Pik3c2g T G 6: 139,715,855 probably null Het
Prkar2a A G 9: 108,740,483 R247G probably damaging Het
Psg26 A G 7: 18,478,473 I319T possibly damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa3 T C 8: 13,631,811 E46G possibly damaging Het
Rbbp5 T A 1: 132,494,275 H304Q probably damaging Het
Scn1a T A 2: 66,273,534 E1783V probably damaging Het
Stag1 A G 9: 100,953,550 N151S probably benign Het
Tbc1d32 C A 10: 56,040,150 A1191S probably damaging Het
Tchh C A 3: 93,443,672 R140S possibly damaging Het
Trank1 A G 9: 111,391,890 Y2565C probably benign Het
Ttn A T 2: 76,914,358 V5449D probably damaging Het
Tubgcp2 G A 7: 139,996,072 P893S possibly damaging Het
Wdfy4 A G 14: 33,020,311 F2325S probably damaging Het
Wdr35 A G 12: 8,989,951 D352G probably benign Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Ypel3 A G 7: 126,775,788 probably benign Het
Zan T A 5: 137,403,762 T4023S unknown Het
Zfp735 T A 11: 73,712,113 C628S possibly damaging Het
Other mutations in Ddx19b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01452:Ddx19b APN 8 111020988 missense probably damaging 1.00
IGL02089:Ddx19b APN 8 111008845 splice site probably benign
IGL02445:Ddx19b APN 8 111008824 missense probably damaging 1.00
IGL02756:Ddx19b APN 8 111011278 splice site probably benign
R0411:Ddx19b UTSW 8 111023964 critical splice donor site probably null
R0483:Ddx19b UTSW 8 111008678 missense probably benign 0.07
R1510:Ddx19b UTSW 8 111015653 missense probably damaging 1.00
R1797:Ddx19b UTSW 8 111012807 missense probably damaging 1.00
R1969:Ddx19b UTSW 8 111008258 missense probably benign 0.00
R1981:Ddx19b UTSW 8 111009343 missense possibly damaging 0.88
R1982:Ddx19b UTSW 8 111009343 missense possibly damaging 0.88
R3771:Ddx19b UTSW 8 111020981 missense probably benign 0.03
R4190:Ddx19b UTSW 8 111011348 missense probably damaging 1.00
R4191:Ddx19b UTSW 8 111011348 missense probably damaging 1.00
R4193:Ddx19b UTSW 8 111011348 missense probably damaging 1.00
R5132:Ddx19b UTSW 8 111022408 missense probably benign
Z1088:Ddx19b UTSW 8 111015575 missense probably benign 0.37
Predicted Primers PCR Primer
(F):5'- AAATGCTCCTGGATCCTGTTGAG -3'
(R):5'- TGAGGGACATTCCTTCCTAGG -3'

Sequencing Primer
(F):5'- AGGATATTCATGCTGTGCTTGC -3'
(R):5'- AAGGTTTCCAGGTGCTCCC -3'
Posted On2016-09-01