Incidental Mutation 'R5435:Fkbpl'
ID428296
Institutional Source Beutler Lab
Gene Symbol Fkbpl
Ensembl Gene ENSMUSG00000033739
Gene NameFK506 binding protein-like
SynonymsWAF-1/CIP1 stabilizing protein 39, NG7, DIR1, Ppiase-X, WISp39
MMRRC Submission 043000-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.899) question?
Stock #R5435 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location34644764-34646324 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 34645329 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 24 (A24T)
Ref Sequence ENSEMBL: ENSMUSP00000037273 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015605] [ENSMUST00000036720] [ENSMUST00000173984] [ENSMUST00000174519] [ENSMUST00000174614] [ENSMUST00000174796]
Predicted Effect probably benign
Transcript: ENSMUST00000015605
SMART Domains Protein: ENSMUSP00000015605
Gene: ENSMUSG00000015461

DomainStartEndE-ValueType
low complexity region 86 110 N/A INTRINSIC
internal_repeat_1 113 156 2.55e-13 PROSPERO
low complexity region 162 180 N/A INTRINSIC
internal_repeat_1 186 230 2.55e-13 PROSPERO
low complexity region 238 255 N/A INTRINSIC
low complexity region 289 301 N/A INTRINSIC
BRLZ 320 384 7.08e-15 SMART
low complexity region 415 428 N/A INTRINSIC
low complexity region 484 497 N/A INTRINSIC
low complexity region 544 557 N/A INTRINSIC
low complexity region 667 693 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036720
AA Change: A24T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000037273
Gene: ENSMUSG00000033739
AA Change: A24T

DomainStartEndE-ValueType
TPR 208 241 2.92e1 SMART
TPR 250 283 4.77e-2 SMART
TPR 284 317 1.89e-5 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173984
SMART Domains Protein: ENSMUSP00000133516
Gene: ENSMUSG00000015461

DomainStartEndE-ValueType
low complexity region 89 113 N/A INTRINSIC
internal_repeat_1 116 159 2.54e-13 PROSPERO
low complexity region 165 183 N/A INTRINSIC
internal_repeat_1 189 233 2.54e-13 PROSPERO
low complexity region 241 258 N/A INTRINSIC
low complexity region 292 304 N/A INTRINSIC
BRLZ 323 387 2.9e-17 SMART
low complexity region 418 431 N/A INTRINSIC
low complexity region 487 500 N/A INTRINSIC
low complexity region 547 560 N/A INTRINSIC
low complexity region 670 696 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000174519
SMART Domains Protein: ENSMUSP00000133558
Gene: ENSMUSG00000015461

DomainStartEndE-ValueType
low complexity region 23 47 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000174600
Predicted Effect probably benign
Transcript: ENSMUST00000174614
Predicted Effect probably benign
Transcript: ENSMUST00000174796
Meta Mutation Damage Score 0.0612 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency 100% (74/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene has similarity to the immunophilin protein family, which play a role in immunoregulation and basic cellular processes involving protein folding and trafficking. The encoded protein is thought to have a potential role in the induced radioresistance. Also it appears to have some involvement in the control of the cell cycle. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene leads to complete embryonic lethality. Heterozygotes develop normally but exhibit enhanced angiogenesis in various experimental and tumor disease models. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310035C23Rik T A 1: 105,741,250 probably benign Het
3425401B19Rik A G 14: 32,661,456 F851L probably benign Het
Abca17 C T 17: 24,267,614 V1480I possibly damaging Het
Acsbg1 G T 9: 54,615,869 Y491* probably null Het
Acsf3 T A 8: 122,780,281 N104K probably damaging Het
Adam23 T C 1: 63,546,453 Y400H possibly damaging Het
Adgra3 G A 5: 49,990,126 T524M probably damaging Het
Aff1 G A 5: 103,754,332 probably benign Het
Anxa9 T C 3: 95,297,250 Y321C probably damaging Het
Ap1g1 T A 8: 109,838,920 Y329N probably damaging Het
Aph1c A T 9: 66,834,501 I33N possibly damaging Het
B3galnt2 A G 13: 13,996,990 E491G probably benign Het
Bdh1 C T 16: 31,456,657 R235C probably damaging Het
Ccar2 A G 14: 70,139,327 L856P probably damaging Het
Ccdc107 A T 4: 43,493,519 D30V probably damaging Het
Ccdc116 G T 16: 17,142,762 H64N probably benign Het
Ccl12 T C 11: 82,103,175 I86T possibly damaging Het
Col2a1 T C 15: 98,000,510 probably benign Het
Col4a4 T A 1: 82,454,007 I1519F unknown Het
Ddx19b T C 8: 111,008,826 Q416R possibly damaging Het
Dnah6 T A 6: 73,060,138 M3374L probably benign Het
Dnajc6 A T 4: 101,606,610 I119F probably damaging Het
Ensa C A 3: 95,622,458 probably benign Het
Fbxo4 C T 15: 3,965,792 V357I possibly damaging Het
Foxf1 G A 8: 121,084,492 G32S probably damaging Het
Gls2 G A 10: 128,195,126 probably benign Het
Gm13599 T A 2: 67,396,152 noncoding transcript Het
Gmnn A G 13: 24,752,101 S197P probably benign Het
Guf1 A T 5: 69,563,169 H324L probably benign Het
H2-Q6 A G 17: 35,425,685 D150G probably damaging Het
Herc3 T A 6: 58,855,806 L152Q probably damaging Het
Hnrnpul2 T G 19: 8,820,318 S13A probably benign Het
Ighv5-4 A G 12: 113,597,663 F46L probably benign Het
Kank1 T G 19: 25,411,143 S727A probably benign Het
Kcnma1 A T 14: 23,528,404 Y201* probably null Het
Lyst A T 13: 13,777,064 H3750L possibly damaging Het
Mettl25 A G 10: 105,779,586 probably null Het
Mpdz A G 4: 81,283,487 probably benign Het
Myh9 C T 15: 77,769,609 V1280I probably benign Het
Neto1 A T 18: 86,398,263 T32S probably benign Het
Nol7 C A 13: 43,401,372 H187Q possibly damaging Het
Olfr992 T A 2: 85,400,470 N21I probably benign Het
Pcdha8 A G 18: 36,993,599 D378G probably damaging Het
Peak1 A G 9: 56,206,486 S694P probably damaging Het
Pih1d1 T A 7: 45,156,272 probably null Het
Pik3c2g T G 6: 139,715,855 probably null Het
Prkar2a A G 9: 108,740,483 R247G probably damaging Het
Psg26 A G 7: 18,478,473 I319T possibly damaging Het
R3hdm4 C T 10: 79,912,458 E162K possibly damaging Het
Rasa3 T C 8: 13,631,811 E46G possibly damaging Het
Rbbp5 T A 1: 132,494,275 H304Q probably damaging Het
Scn1a T A 2: 66,273,534 E1783V probably damaging Het
Stag1 A G 9: 100,953,550 N151S probably benign Het
Tbc1d32 C A 10: 56,040,150 A1191S probably damaging Het
Tchh C A 3: 93,443,672 R140S possibly damaging Het
Trank1 A G 9: 111,391,890 Y2565C probably benign Het
Ttn A T 2: 76,914,358 V5449D probably damaging Het
Tubgcp2 G A 7: 139,996,072 P893S possibly damaging Het
Wdfy4 A G 14: 33,020,311 F2325S probably damaging Het
Wdr35 A G 12: 8,989,951 D352G probably benign Het
Wee1 TCCCC TCCC 7: 110,124,569 probably null Het
Ypel3 A G 7: 126,775,788 probably benign Het
Zan T A 5: 137,403,762 T4023S unknown Het
Zfp735 T A 11: 73,712,113 C628S possibly damaging Het
Other mutations in Fkbpl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01085:Fkbpl APN 17 34645744 missense probably damaging 1.00
IGL02129:Fkbpl APN 17 34645978 missense probably damaging 0.99
IGL02322:Fkbpl APN 17 34645324 missense probably benign 0.00
IGL03331:Fkbpl APN 17 34645687 missense probably damaging 1.00
IGL03347:Fkbpl APN 17 34646313 unclassified probably benign
R0278:Fkbpl UTSW 17 34645410 nonsense probably null
R0314:Fkbpl UTSW 17 34646052 missense possibly damaging 0.62
R0540:Fkbpl UTSW 17 34645359 missense probably benign
R0607:Fkbpl UTSW 17 34645359 missense probably benign
R1866:Fkbpl UTSW 17 34645823 missense possibly damaging 0.50
R4483:Fkbpl UTSW 17 34646295 missense probably damaging 1.00
R4746:Fkbpl UTSW 17 34645329 missense probably benign
R4795:Fkbpl UTSW 17 34645329 missense probably benign
R4796:Fkbpl UTSW 17 34645329 missense probably benign
R4839:Fkbpl UTSW 17 34645865 missense probably benign
R5268:Fkbpl UTSW 17 34645329 missense probably benign
R5290:Fkbpl UTSW 17 34645329 missense probably benign
R5357:Fkbpl UTSW 17 34645329 missense probably benign
R5358:Fkbpl UTSW 17 34645329 missense probably benign
R5359:Fkbpl UTSW 17 34645329 missense probably benign
R5360:Fkbpl UTSW 17 34645329 missense probably benign
R5361:Fkbpl UTSW 17 34645329 missense probably benign
R5363:Fkbpl UTSW 17 34645329 missense probably benign
R5406:Fkbpl UTSW 17 34645329 missense probably benign
R5533:Fkbpl UTSW 17 34645329 missense probably benign
R5535:Fkbpl UTSW 17 34645329 missense probably benign
R5722:Fkbpl UTSW 17 34645329 missense probably benign
R5723:Fkbpl UTSW 17 34645329 missense probably benign
R5760:Fkbpl UTSW 17 34645329 missense probably benign
R5861:Fkbpl UTSW 17 34645329 missense probably benign
R5941:Fkbpl UTSW 17 34645329 missense probably benign
R6109:Fkbpl UTSW 17 34645329 missense probably benign
R6124:Fkbpl UTSW 17 34645329 missense probably benign
R6146:Fkbpl UTSW 17 34645329 missense probably benign
R6148:Fkbpl UTSW 17 34645329 missense probably benign
R6185:Fkbpl UTSW 17 34645329 missense probably benign
R6186:Fkbpl UTSW 17 34645329 missense probably benign
R6186:Fkbpl UTSW 17 34646179 missense probably benign 0.12
R6344:Fkbpl UTSW 17 34645570 missense probably damaging 1.00
R6481:Fkbpl UTSW 17 34645414 missense possibly damaging 0.95
R6564:Fkbpl UTSW 17 34646266 missense probably benign 0.42
Predicted Primers PCR Primer
(F):5'- ACGAGGAGTCTTAACTAGGAATTCTG -3'
(R):5'- AGGTGCTCTGCCATCTCATTG -3'

Sequencing Primer
(F):5'- AATTCTGGAATTTACATGGTTTCGG -3'
(R):5'- TGGTTGAGACTTGAAATTGATCAGAG -3'
Posted On2016-09-01