Incidental Mutation 'R5437:Pnkd'
List |< first << previous [record 37 of 59] next >> last >|
ID428401
Institutional Source Beutler Lab
Gene Symbol Pnkd
Ensembl Gene ENSMUSG00000026179
Gene Nameparoxysmal nonkinesiogenic dyskinesia
Synonyms2810403H05Rik, Brp17, 2210013N15Rik
MMRRC Submission 043002-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.171) question?
Stock #R5437 (G1)
Quality Score196
Status Validated
Chromosome1
Chromosomal Location74284930-74353694 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74349737 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 214 (V214A)
Ref Sequence ENSEMBL: ENSMUSP00000027370 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027370] [ENSMUST00000087225] [ENSMUST00000087226]
Predicted Effect possibly damaging
Transcript: ENSMUST00000027370
AA Change: V214A

PolyPhen 2 Score 0.605 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000027370
Gene: ENSMUSG00000026179
AA Change: V214A

DomainStartEndE-ValueType
Blast:Lactamase_B 4 79 1e-24 BLAST
Lactamase_B 129 291 1.05e-31 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000087225
AA Change: V189A

PolyPhen 2 Score 0.601 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000084477
Gene: ENSMUSG00000026179
AA Change: V189A

DomainStartEndE-ValueType
transmembrane domain 6 28 N/A INTRINSIC
transmembrane domain 49 68 N/A INTRINSIC
Lactamase_B 104 266 1.05e-31 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000087226
AA Change: V253A

PolyPhen 2 Score 0.401 (Sensitivity: 0.89; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000084478
Gene: ENSMUSG00000026179
AA Change: V253A

DomainStartEndE-ValueType
low complexity region 43 61 N/A INTRINSIC
Pfam:DUF4748 71 121 2.9e-23 PFAM
Lactamase_B 168 330 1.05e-31 SMART
Pfam:HAGH_C 331 421 6.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138620
Meta Mutation Damage Score 0.082 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is thought to play a role in the regulation of myofibrillogenesis. Mutations in this gene have been associated with the movement disorder paroxysmal non-kinesigenic dyskinesia. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2010]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit decreased levels of the dopamine metabolite 3,4-dihydroxyphenylacetic acid (DOPAC) and lower DOPAC/dopamine ratios after injection of caffeine or ethanol. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 G A 11: 110,319,796 Q186* probably null Het
Acaca G A 11: 84,346,820 probably null Het
Acsm3 C A 7: 119,778,497 probably benign Het
Aoc1 C A 6: 48,907,750 Q576K probably benign Het
Atp6v0a4 T A 6: 38,076,733 N378I probably damaging Het
BC003331 T G 1: 150,363,518 I385L probably benign Het
Cacna1i A T 15: 80,371,529 H871L probably damaging Het
Clic4 C G 4: 135,217,246 R206P probably damaging Het
Commd9 G A 2: 101,901,028 G186D probably damaging Het
Cpne9 C T 6: 113,304,630 probably benign Het
Crhr2 C T 6: 55,100,733 V196I probably damaging Het
Dctn5 T A 7: 122,133,329 probably benign Het
Dhtkd1 C T 2: 5,924,119 R247Q probably benign Het
Dmrta1 G A 4: 89,691,756 G318R possibly damaging Het
Dpp6 T A 5: 27,663,501 Y487* probably null Het
Eef1akmt3 A T 10: 127,033,247 N119K probably damaging Het
Eloa A T 4: 136,012,885 L75Q probably damaging Het
Fat3 G A 9: 16,085,308 T1202M probably damaging Het
Fcho2 A G 13: 98,777,474 I205T possibly damaging Het
Fkbp10 A C 11: 100,421,023 D174A probably damaging Het
Gcnt2 T A 13: 40,861,176 F274L probably damaging Het
Gtf3c1 A T 7: 125,667,368 C969S probably damaging Het
Hook3 T C 8: 26,061,422 E130G probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Itsn1 T A 16: 91,818,591 probably benign Het
Kif13b C T 14: 64,806,114 R1788C probably damaging Het
Kif3a C T 11: 53,598,726 S135F probably damaging Het
Klf5 C T 14: 99,301,459 R23* probably null Het
Lcn5 A G 2: 25,658,011 I11V probably benign Het
Mpp7 A T 18: 7,458,930 probably null Het
Mroh5 T C 15: 73,787,969 I338V probably benign Het
Mthfd2l A G 5: 90,948,898 N126S possibly damaging Het
Myo18b G T 5: 112,757,573 A2053E possibly damaging Het
Naip6 A T 13: 100,303,304 C318* probably null Het
Ndufs7 C T 10: 80,254,924 R116C possibly damaging Het
Olfr1378 T C 11: 50,969,108 M30T probably benign Het
Popdc2 T G 16: 38,362,901 V82G probably benign Het
Prkdc A T 16: 15,769,875 L2541F possibly damaging Het
Ptpn9 A T 9: 57,020,037 H66L possibly damaging Het
Pygm T A 19: 6,390,382 N397K probably damaging Het
Rabgap1l T A 1: 160,722,147 E324D probably damaging Het
Rnf6 G A 5: 146,210,280 R643C probably damaging Het
Ryr2 C T 13: 11,655,713 V3466M probably damaging Het
Scn7a A G 2: 66,676,346 Y1400H probably damaging Het
Sept10 T A 10: 59,176,959 N279I probably damaging Het
Sh3rf2 A T 18: 42,141,014 Y415F probably benign Het
Sorcs1 T C 19: 50,252,602 T449A probably benign Het
Tcam1 C T 11: 106,285,423 T325M probably damaging Het
Tctn1 A G 5: 122,258,879 I147T probably benign Het
Tet1 G T 10: 62,814,451 H30Q probably benign Het
Tmem109 A G 19: 10,872,014 I159T probably damaging Het
Tmem40 C T 6: 115,759,031 probably benign Het
Tnfrsf21 C T 17: 43,037,862 P122S possibly damaging Het
Uaca A G 9: 60,871,451 D1038G probably benign Het
Ubr2 C G 17: 46,963,697 E852D probably benign Het
Ubr3 A T 2: 69,944,390 N518I probably damaging Het
Unc80 T G 1: 66,654,578 L2596R possibly damaging Het
Zcchc3 G A 2: 152,414,732 P16S probably benign Het
Other mutations in Pnkd
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Pnkd APN 1 74285922 missense probably damaging 1.00
IGL01322:Pnkd APN 1 74351557 missense probably damaging 1.00
IGL02536:Pnkd APN 1 74351900 missense probably damaging 1.00
IGL02712:Pnkd APN 1 74349868 missense possibly damaging 0.62
R0731:Pnkd UTSW 1 74351541 missense probably damaging 1.00
R0741:Pnkd UTSW 1 74351859 missense possibly damaging 0.56
R1483:Pnkd UTSW 1 74349391 missense probably benign 0.08
R1497:Pnkd UTSW 1 74351522 splice site probably null
R1515:Pnkd UTSW 1 74349809 missense probably null 1.00
R1759:Pnkd UTSW 1 74348763 missense probably damaging 0.98
R1969:Pnkd UTSW 1 74351849 missense probably damaging 0.97
R1970:Pnkd UTSW 1 74285910 unclassified probably null
R3508:Pnkd UTSW 1 74350634 missense probably benign 0.01
R4714:Pnkd UTSW 1 74351782 missense probably damaging 1.00
R4811:Pnkd UTSW 1 74349405 splice site probably null
R5931:Pnkd UTSW 1 74350674 missense probably benign
R6698:Pnkd UTSW 1 74350677 missense probably damaging 1.00
R6994:Pnkd UTSW 1 74293176 intron probably null
Predicted Primers PCR Primer
(F):5'- AGAAGACTGCATGAGCCAGC -3'
(R):5'- ACAACACTTCCAAATGTGACATGG -3'

Sequencing Primer
(F):5'- CCAGCTATGGTCAGAAGAGG -3'
(R):5'- TGGAACAGTGGCCACTCTG -3'
Posted On2016-09-01