Incidental Mutation 'R5437:Commd9'
ID428408
Institutional Source Beutler Lab
Gene Symbol Commd9
Ensembl Gene ENSMUSG00000027163
Gene NameCOMM domain containing 9
Synonyms1810029F08Rik
MMRRC Submission 043002-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5437 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location101886247-101901646 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 101901028 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 186 (G186D)
Ref Sequence ENSEMBL: ENSMUSP00000028584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028584]
Predicted Effect probably damaging
Transcript: ENSMUST00000028584
AA Change: G186D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000028584
Gene: ENSMUSG00000027163
AA Change: G186D

DomainStartEndE-ValueType
Pfam:HCaRG 15 194 9e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131287
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133576
Meta Mutation Damage Score 0.332 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (63/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality, neural tube edema, and cardiovascular abnormalities including hemorrhages, heart hypoplasia, focal myocardial wall necrosis and narrowing of the dorsal aortas, and alterations in cranial blood vessels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 G A 11: 110,319,796 Q186* probably null Het
Acaca G A 11: 84,346,820 probably null Het
Acsm3 C A 7: 119,778,497 probably benign Het
Aoc1 C A 6: 48,907,750 Q576K probably benign Het
Atp6v0a4 T A 6: 38,076,733 N378I probably damaging Het
BC003331 T G 1: 150,363,518 I385L probably benign Het
Cacna1i A T 15: 80,371,529 H871L probably damaging Het
Clic4 C G 4: 135,217,246 R206P probably damaging Het
Cpne9 C T 6: 113,304,630 probably benign Het
Crhr2 C T 6: 55,100,733 V196I probably damaging Het
Dctn5 T A 7: 122,133,329 probably benign Het
Dhtkd1 C T 2: 5,924,119 R247Q probably benign Het
Dmrta1 G A 4: 89,691,756 G318R possibly damaging Het
Dpp6 T A 5: 27,663,501 Y487* probably null Het
Eef1akmt3 A T 10: 127,033,247 N119K probably damaging Het
Eloa A T 4: 136,012,885 L75Q probably damaging Het
Fat3 G A 9: 16,085,308 T1202M probably damaging Het
Fcho2 A G 13: 98,777,474 I205T possibly damaging Het
Fkbp10 A C 11: 100,421,023 D174A probably damaging Het
Gcnt2 T A 13: 40,861,176 F274L probably damaging Het
Gtf3c1 A T 7: 125,667,368 C969S probably damaging Het
Hook3 T C 8: 26,061,422 E130G probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Itsn1 T A 16: 91,818,591 probably benign Het
Kif13b C T 14: 64,806,114 R1788C probably damaging Het
Kif3a C T 11: 53,598,726 S135F probably damaging Het
Klf5 C T 14: 99,301,459 R23* probably null Het
Lcn5 A G 2: 25,658,011 I11V probably benign Het
Mpp7 A T 18: 7,458,930 probably null Het
Mroh5 T C 15: 73,787,969 I338V probably benign Het
Mthfd2l A G 5: 90,948,898 N126S possibly damaging Het
Myo18b G T 5: 112,757,573 A2053E possibly damaging Het
Naip6 A T 13: 100,303,304 C318* probably null Het
Ndufs7 C T 10: 80,254,924 R116C possibly damaging Het
Olfr1378 T C 11: 50,969,108 M30T probably benign Het
Pnkd T C 1: 74,349,737 V214A possibly damaging Het
Popdc2 T G 16: 38,362,901 V82G probably benign Het
Prkdc A T 16: 15,769,875 L2541F possibly damaging Het
Ptpn9 A T 9: 57,020,037 H66L possibly damaging Het
Pygm T A 19: 6,390,382 N397K probably damaging Het
Rabgap1l T A 1: 160,722,147 E324D probably damaging Het
Rnf6 G A 5: 146,210,280 R643C probably damaging Het
Ryr2 C T 13: 11,655,713 V3466M probably damaging Het
Scn7a A G 2: 66,676,346 Y1400H probably damaging Het
Sept10 T A 10: 59,176,959 N279I probably damaging Het
Sh3rf2 A T 18: 42,141,014 Y415F probably benign Het
Sorcs1 T C 19: 50,252,602 T449A probably benign Het
Tcam1 C T 11: 106,285,423 T325M probably damaging Het
Tctn1 A G 5: 122,258,879 I147T probably benign Het
Tet1 G T 10: 62,814,451 H30Q probably benign Het
Tmem109 A G 19: 10,872,014 I159T probably damaging Het
Tmem40 C T 6: 115,759,031 probably benign Het
Tnfrsf21 C T 17: 43,037,862 P122S possibly damaging Het
Uaca A G 9: 60,871,451 D1038G probably benign Het
Ubr2 C G 17: 46,963,697 E852D probably benign Het
Ubr3 A T 2: 69,944,390 N518I probably damaging Het
Unc80 T G 1: 66,654,578 L2596R possibly damaging Het
Zcchc3 G A 2: 152,414,732 P16S probably benign Het
Other mutations in Commd9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00475:Commd9 APN 2 101895156 nonsense probably null
IGL02232:Commd9 APN 2 101900979 missense probably benign 0.34
IGL03109:Commd9 APN 2 101897170 missense probably benign
R1873:Commd9 UTSW 2 101897157 missense probably benign 0.09
R1933:Commd9 UTSW 2 101901031 missense probably damaging 1.00
R3826:Commd9 UTSW 2 101897141 missense probably benign 0.18
R3828:Commd9 UTSW 2 101897141 missense probably benign 0.18
R3829:Commd9 UTSW 2 101897141 missense probably benign 0.18
R3968:Commd9 UTSW 2 101897141 missense probably benign 0.18
R3969:Commd9 UTSW 2 101897141 missense probably benign 0.18
R3970:Commd9 UTSW 2 101897141 missense probably benign 0.18
R4059:Commd9 UTSW 2 101895154 missense possibly damaging 0.93
R4795:Commd9 UTSW 2 101898896 missense probably benign 0.00
R5289:Commd9 UTSW 2 101898894 missense probably benign 0.00
R5426:Commd9 UTSW 2 101898875 missense probably damaging 1.00
R7209:Commd9 UTSW 2 101895138 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CATACAGCTGGGAAGGGTTC -3'
(R):5'- CTCAGAGATGGAGGCTTCTTCTC -3'

Sequencing Primer
(F):5'- GTCTGTGTGGAGAGAAAC -3'
(R):5'- CTTCTCATCTTCAGGAAAAACAGGAG -3'
Posted On2016-09-01