Incidental Mutation 'R5437:Rnf6'
ID428417
Institutional Source Beutler Lab
Gene Symbol Rnf6
Ensembl Gene ENSMUSG00000029634
Gene Namering finger protein (C3H2C3 type) 6
Synonyms5730419H05Rik, 1200013I08Rik
MMRRC Submission 043002-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.737) question?
Stock #R5437 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location146209192-146221555 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 146210280 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Cysteine at position 643 (R643C)
Ref Sequence ENSEMBL: ENSMUSP00000128774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067837] [ENSMUST00000159074] [ENSMUST00000161331] [ENSMUST00000161574] [ENSMUST00000161859] [ENSMUST00000169407]
Predicted Effect probably damaging
Transcript: ENSMUST00000067837
AA Change: R643C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000067559
Gene: ENSMUSG00000029634
AA Change: R643C

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 187 215 N/A INTRINSIC
low complexity region 513 530 N/A INTRINSIC
RING 614 654 6.68e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000159074
SMART Domains Protein: ENSMUSP00000123926
Gene: ENSMUSG00000029634

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
low complexity region 90 106 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161331
SMART Domains Protein: ENSMUSP00000125611
Gene: ENSMUSG00000029634

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000161574
SMART Domains Protein: ENSMUSP00000123730
Gene: ENSMUSG00000029634

DomainStartEndE-ValueType
low complexity region 15 27 N/A INTRINSIC
low complexity region 90 106 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000161859
AA Change: R643C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000124293
Gene: ENSMUSG00000029634
AA Change: R643C

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 187 215 N/A INTRINSIC
low complexity region 513 530 N/A INTRINSIC
RING 614 654 6.68e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000162219
SMART Domains Protein: ENSMUSP00000123708
Gene: ENSMUSG00000029634

DomainStartEndE-ValueType
low complexity region 49 65 N/A INTRINSIC
low complexity region 157 185 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000169407
AA Change: R643C

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000128774
Gene: ENSMUSG00000029634
AA Change: R643C

DomainStartEndE-ValueType
low complexity region 4 16 N/A INTRINSIC
low complexity region 79 95 N/A INTRINSIC
low complexity region 187 215 N/A INTRINSIC
low complexity region 513 530 N/A INTRINSIC
RING 614 654 6.68e-6 SMART
Meta Mutation Damage Score 0.0212 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains a RING-H2 finger motif. Deletions and mutations in this gene were detected in esophageal squamous cell carcinoma (ESCC), suggesting that this protein may be a potential tumor suppressor. Studies of the mouse counterpart suggested a role of this protein in the transcription regulation that controls germinal differentiation. Multiple alternatively spliced transcript variants encoding the same protein are observed. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 G A 11: 110,319,796 Q186* probably null Het
Acaca G A 11: 84,346,820 probably null Het
Acsm3 C A 7: 119,778,497 probably benign Het
Aoc1 C A 6: 48,907,750 Q576K probably benign Het
Atp6v0a4 T A 6: 38,076,733 N378I probably damaging Het
BC003331 T G 1: 150,363,518 I385L probably benign Het
Cacna1i A T 15: 80,371,529 H871L probably damaging Het
Clic4 C G 4: 135,217,246 R206P probably damaging Het
Commd9 G A 2: 101,901,028 G186D probably damaging Het
Cpne9 C T 6: 113,304,630 probably benign Het
Crhr2 C T 6: 55,100,733 V196I probably damaging Het
Dctn5 T A 7: 122,133,329 probably benign Het
Dhtkd1 C T 2: 5,924,119 R247Q probably benign Het
Dmrta1 G A 4: 89,691,756 G318R possibly damaging Het
Dpp6 T A 5: 27,663,501 Y487* probably null Het
Eef1akmt3 A T 10: 127,033,247 N119K probably damaging Het
Eloa A T 4: 136,012,885 L75Q probably damaging Het
Fat3 G A 9: 16,085,308 T1202M probably damaging Het
Fcho2 A G 13: 98,777,474 I205T possibly damaging Het
Fkbp10 A C 11: 100,421,023 D174A probably damaging Het
Gcnt2 T A 13: 40,861,176 F274L probably damaging Het
Gtf3c1 A T 7: 125,667,368 C969S probably damaging Het
Hook3 T C 8: 26,061,422 E130G probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Itsn1 T A 16: 91,818,591 probably benign Het
Kif13b C T 14: 64,806,114 R1788C probably damaging Het
Kif3a C T 11: 53,598,726 S135F probably damaging Het
Klf5 C T 14: 99,301,459 R23* probably null Het
Lcn5 A G 2: 25,658,011 I11V probably benign Het
Mpp7 A T 18: 7,458,930 probably null Het
Mroh5 T C 15: 73,787,969 I338V probably benign Het
Mthfd2l A G 5: 90,948,898 N126S possibly damaging Het
Myo18b G T 5: 112,757,573 A2053E possibly damaging Het
Naip6 A T 13: 100,303,304 C318* probably null Het
Ndufs7 C T 10: 80,254,924 R116C possibly damaging Het
Olfr1378 T C 11: 50,969,108 M30T probably benign Het
Pnkd T C 1: 74,349,737 V214A possibly damaging Het
Popdc2 T G 16: 38,362,901 V82G probably benign Het
Prkdc A T 16: 15,769,875 L2541F possibly damaging Het
Ptpn9 A T 9: 57,020,037 H66L possibly damaging Het
Pygm T A 19: 6,390,382 N397K probably damaging Het
Rabgap1l T A 1: 160,722,147 E324D probably damaging Het
Ryr2 C T 13: 11,655,713 V3466M probably damaging Het
Scn7a A G 2: 66,676,346 Y1400H probably damaging Het
Sept10 T A 10: 59,176,959 N279I probably damaging Het
Sh3rf2 A T 18: 42,141,014 Y415F probably benign Het
Sorcs1 T C 19: 50,252,602 T449A probably benign Het
Tcam1 C T 11: 106,285,423 T325M probably damaging Het
Tctn1 A G 5: 122,258,879 I147T probably benign Het
Tet1 G T 10: 62,814,451 H30Q probably benign Het
Tmem109 A G 19: 10,872,014 I159T probably damaging Het
Tmem40 C T 6: 115,759,031 probably benign Het
Tnfrsf21 C T 17: 43,037,862 P122S possibly damaging Het
Uaca A G 9: 60,871,451 D1038G probably benign Het
Ubr2 C G 17: 46,963,697 E852D probably benign Het
Ubr3 A T 2: 69,944,390 N518I probably damaging Het
Unc80 T G 1: 66,654,578 L2596R possibly damaging Het
Zcchc3 G A 2: 152,414,732 P16S probably benign Het
Other mutations in Rnf6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00706:Rnf6 APN 5 146211905 missense possibly damaging 0.86
IGL01432:Rnf6 APN 5 146216121 missense possibly damaging 0.61
IGL01722:Rnf6 APN 5 146210226 missense probably benign
IGL01866:Rnf6 APN 5 146210907 missense probably damaging 0.99
R0141:Rnf6 UTSW 5 146211835 missense possibly damaging 0.95
R0551:Rnf6 UTSW 5 146211395 missense possibly damaging 0.65
R0619:Rnf6 UTSW 5 146210721 missense possibly damaging 0.58
R0685:Rnf6 UTSW 5 146211658 missense probably damaging 0.99
R1363:Rnf6 UTSW 5 146211559 missense probably benign
R1387:Rnf6 UTSW 5 146211245 missense probably benign 0.00
R1671:Rnf6 UTSW 5 146211188 nonsense probably null
R2047:Rnf6 UTSW 5 146211864 missense probably damaging 0.99
R2074:Rnf6 UTSW 5 146210906 missense probably damaging 0.98
R2107:Rnf6 UTSW 5 146211281 missense probably damaging 0.99
R2871:Rnf6 UTSW 5 146210405 missense probably benign 0.07
R2871:Rnf6 UTSW 5 146210405 missense probably benign 0.07
R2873:Rnf6 UTSW 5 146210405 missense probably benign 0.07
R2874:Rnf6 UTSW 5 146210405 missense probably benign 0.07
R4361:Rnf6 UTSW 5 146211279 missense probably damaging 1.00
R5421:Rnf6 UTSW 5 146210529 missense probably benign 0.06
R5614:Rnf6 UTSW 5 146218100 splice site probably null
R5848:Rnf6 UTSW 5 146211149 missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- CCATCCCTACTGCAGTATTAGGAG -3'
(R):5'- GCGATGATGATCCAATTCGTG -3'

Sequencing Primer
(F):5'- CCCTACTGCAGTATTAGGAGAAAGAC -3'
(R):5'- GGTTTAACCAAAGAGCAGATTGAC -3'
Posted On2016-09-01