Incidental Mutation 'R5437:Aoc1'
ID428419
Institutional Source Beutler Lab
Gene Symbol Aoc1
Ensembl Gene ENSMUSG00000029811
Gene Nameamine oxidase, copper-containing 1
SynonymsAbp1, 1600012D06Rik
MMRRC Submission 043002-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5437 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location48872896-48909188 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 48907750 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Lysine at position 576 (Q576K)
Ref Sequence ENSEMBL: ENSMUSP00000128816 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031835] [ENSMUST00000162948] [ENSMUST00000167529] [ENSMUST00000204856]
Predicted Effect probably benign
Transcript: ENSMUST00000031835
AA Change: Q576K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031835
Gene: ENSMUSG00000029811
AA Change: Q576K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 8.8e-26 PFAM
Pfam:Cu_amine_oxidN3 146 246 4.1e-20 PFAM
low complexity region 259 274 N/A INTRINSIC
Pfam:Cu_amine_oxid 305 720 6.1e-132 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000161184
Predicted Effect probably benign
Transcript: ENSMUST00000162948
AA Change: Q576K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000124085
Gene: ENSMUSG00000029811
AA Change: Q576K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 8.8e-26 PFAM
Pfam:Cu_amine_oxidN3 146 246 4.1e-20 PFAM
low complexity region 259 274 N/A INTRINSIC
Pfam:Cu_amine_oxid 305 720 6.1e-132 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000167529
AA Change: Q576K

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000128816
Gene: ENSMUSG00000029811
AA Change: Q576K

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 44 130 2.4e-30 PFAM
Pfam:Cu_amine_oxidN3 146 246 1.5e-23 PFAM
low complexity region 259 274 N/A INTRINSIC
Pfam:Cu_amine_oxid 305 717 1.5e-123 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000204856
SMART Domains Protein: ENSMUSP00000144764
Gene: ENSMUSG00000029811

DomainStartEndE-ValueType
signal peptide 1 49 N/A INTRINSIC
Pfam:Cu_amine_oxidN2 66 152 4.3e-28 PFAM
Pfam:Cu_amine_oxidN3 168 250 8.9e-15 PFAM
Meta Mutation Damage Score 0.0512 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a metal-binding membrane glycoprotein that oxidatively deaminates putrescine, histamine, and related compounds. The encoded protein is inhibited by amiloride, a diuretic that acts by closing epithelial sodium ion channels. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Jan 2013]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 G A 11: 110,319,796 Q186* probably null Het
Acaca G A 11: 84,346,820 probably null Het
Acsm3 C A 7: 119,778,497 probably benign Het
Atp6v0a4 T A 6: 38,076,733 N378I probably damaging Het
BC003331 T G 1: 150,363,518 I385L probably benign Het
Cacna1i A T 15: 80,371,529 H871L probably damaging Het
Clic4 C G 4: 135,217,246 R206P probably damaging Het
Commd9 G A 2: 101,901,028 G186D probably damaging Het
Cpne9 C T 6: 113,304,630 probably benign Het
Crhr2 C T 6: 55,100,733 V196I probably damaging Het
Dctn5 T A 7: 122,133,329 probably benign Het
Dhtkd1 C T 2: 5,924,119 R247Q probably benign Het
Dmrta1 G A 4: 89,691,756 G318R possibly damaging Het
Dpp6 T A 5: 27,663,501 Y487* probably null Het
Eef1akmt3 A T 10: 127,033,247 N119K probably damaging Het
Eloa A T 4: 136,012,885 L75Q probably damaging Het
Fat3 G A 9: 16,085,308 T1202M probably damaging Het
Fcho2 A G 13: 98,777,474 I205T possibly damaging Het
Fkbp10 A C 11: 100,421,023 D174A probably damaging Het
Gcnt2 T A 13: 40,861,176 F274L probably damaging Het
Gtf3c1 A T 7: 125,667,368 C969S probably damaging Het
Hook3 T C 8: 26,061,422 E130G probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Itsn1 T A 16: 91,818,591 probably benign Het
Kif13b C T 14: 64,806,114 R1788C probably damaging Het
Kif3a C T 11: 53,598,726 S135F probably damaging Het
Klf5 C T 14: 99,301,459 R23* probably null Het
Lcn5 A G 2: 25,658,011 I11V probably benign Het
Mpp7 A T 18: 7,458,930 probably null Het
Mroh5 T C 15: 73,787,969 I338V probably benign Het
Mthfd2l A G 5: 90,948,898 N126S possibly damaging Het
Myo18b G T 5: 112,757,573 A2053E possibly damaging Het
Naip6 A T 13: 100,303,304 C318* probably null Het
Ndufs7 C T 10: 80,254,924 R116C possibly damaging Het
Olfr1378 T C 11: 50,969,108 M30T probably benign Het
Pnkd T C 1: 74,349,737 V214A possibly damaging Het
Popdc2 T G 16: 38,362,901 V82G probably benign Het
Prkdc A T 16: 15,769,875 L2541F possibly damaging Het
Ptpn9 A T 9: 57,020,037 H66L possibly damaging Het
Pygm T A 19: 6,390,382 N397K probably damaging Het
Rabgap1l T A 1: 160,722,147 E324D probably damaging Het
Rnf6 G A 5: 146,210,280 R643C probably damaging Het
Ryr2 C T 13: 11,655,713 V3466M probably damaging Het
Scn7a A G 2: 66,676,346 Y1400H probably damaging Het
Sept10 T A 10: 59,176,959 N279I probably damaging Het
Sh3rf2 A T 18: 42,141,014 Y415F probably benign Het
Sorcs1 T C 19: 50,252,602 T449A probably benign Het
Tcam1 C T 11: 106,285,423 T325M probably damaging Het
Tctn1 A G 5: 122,258,879 I147T probably benign Het
Tet1 G T 10: 62,814,451 H30Q probably benign Het
Tmem109 A G 19: 10,872,014 I159T probably damaging Het
Tmem40 C T 6: 115,759,031 probably benign Het
Tnfrsf21 C T 17: 43,037,862 P122S possibly damaging Het
Uaca A G 9: 60,871,451 D1038G probably benign Het
Ubr2 C G 17: 46,963,697 E852D probably benign Het
Ubr3 A T 2: 69,944,390 N518I probably damaging Het
Unc80 T G 1: 66,654,578 L2596R possibly damaging Het
Zcchc3 G A 2: 152,414,732 P16S probably benign Het
Other mutations in Aoc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00837:Aoc1 APN 6 48908664 missense possibly damaging 0.92
IGL01115:Aoc1 APN 6 48906197 missense probably damaging 1.00
IGL01626:Aoc1 APN 6 48906531 missense probably damaging 1.00
IGL01891:Aoc1 APN 6 48908842 unclassified probably benign
IGL01908:Aoc1 APN 6 48906756 missense probably damaging 1.00
IGL01919:Aoc1 APN 6 48908289 missense probably damaging 1.00
IGL01960:Aoc1 APN 6 48908603 missense probably benign 0.00
IGL02102:Aoc1 APN 6 48905962 missense probably damaging 0.99
IGL02121:Aoc1 APN 6 48906320 unclassified probably null
IGL02229:Aoc1 APN 6 48905909 nonsense probably null
IGL02325:Aoc1 APN 6 48905895 missense possibly damaging 0.46
IGL02626:Aoc1 APN 6 48906110 missense probably benign 0.04
IGL02737:Aoc1 APN 6 48907643 missense probably benign 0.01
IGL03244:Aoc1 APN 6 48905822 missense possibly damaging 0.79
IGL03371:Aoc1 APN 6 48906446 missense probably benign 0.05
R0100:Aoc1 UTSW 6 48908604 missense possibly damaging 0.92
R0835:Aoc1 UTSW 6 48905514 missense probably damaging 1.00
R1240:Aoc1 UTSW 6 48905615 missense probably benign 0.10
R1400:Aoc1 UTSW 6 48906283 nonsense probably null
R1400:Aoc1 UTSW 6 48906711 missense probably benign
R1443:Aoc1 UTSW 6 48905445 missense possibly damaging 0.95
R1447:Aoc1 UTSW 6 48906242 missense probably benign 0.00
R1572:Aoc1 UTSW 6 48905786 missense possibly damaging 0.48
R1850:Aoc1 UTSW 6 48905268 missense probably benign 0.19
R2008:Aoc1 UTSW 6 48905897 missense probably damaging 1.00
R2256:Aoc1 UTSW 6 48906440 missense possibly damaging 0.95
R3429:Aoc1 UTSW 6 48906076 missense probably benign
R3430:Aoc1 UTSW 6 48906076 missense probably benign
R3432:Aoc1 UTSW 6 48905844 missense probably damaging 1.00
R3783:Aoc1 UTSW 6 48905655 missense probably damaging 1.00
R3786:Aoc1 UTSW 6 48905655 missense probably damaging 1.00
R3787:Aoc1 UTSW 6 48905655 missense probably damaging 1.00
R4024:Aoc1 UTSW 6 48908269 missense probably damaging 1.00
R4025:Aoc1 UTSW 6 48908269 missense probably damaging 1.00
R4455:Aoc1 UTSW 6 48905467 missense probably damaging 0.98
R4510:Aoc1 UTSW 6 48907806 missense probably damaging 0.99
R4511:Aoc1 UTSW 6 48907806 missense probably damaging 0.99
R4525:Aoc1 UTSW 6 48906675 missense probably damaging 1.00
R4659:Aoc1 UTSW 6 48906076 missense probably benign
R4876:Aoc1 UTSW 6 48906747 missense possibly damaging 0.78
R5150:Aoc1 UTSW 6 48906150 missense possibly damaging 0.88
R5153:Aoc1 UTSW 6 48908747 missense probably benign 0.19
R6000:Aoc1 UTSW 6 48907639 missense probably benign 0.05
R6112:Aoc1 UTSW 6 48908691 missense probably damaging 1.00
R6195:Aoc1 UTSW 6 48908677 missense probably damaging 1.00
R6252:Aoc1 UTSW 6 48906081 missense probably benign 0.01
R6703:Aoc1 UTSW 6 48905714 missense probably damaging 1.00
R6748:Aoc1 UTSW 6 48906294 missense possibly damaging 0.84
R6765:Aoc1 UTSW 6 48905937 missense probably benign 0.00
R6935:Aoc1 UTSW 6 48908227 missense probably damaging 1.00
R7002:Aoc1 UTSW 6 48905876 missense probably benign
R7066:Aoc1 UTSW 6 48908619 missense probably damaging 1.00
R7120:Aoc1 UTSW 6 48906597 missense probably damaging 1.00
R7234:Aoc1 UTSW 6 48905816 nonsense probably null
R7362:Aoc1 UTSW 6 48905411 missense probably benign 0.18
X0066:Aoc1 UTSW 6 48908252 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTTCTCCACTGCTGGGTG -3'
(R):5'- TGCTCAGAGCCTGGAGAAAC -3'

Sequencing Primer
(F):5'- CATCTTACAAACAGAAAGGTCTCTG -3'
(R):5'- AATCACTGAAGGCAGCCCCTG -3'
Posted On2016-09-01