Incidental Mutation 'R5437:Crhr2'
ID428420
Institutional Source Beutler Lab
Gene Symbol Crhr2
Ensembl Gene ENSMUSG00000003476
Gene Namecorticotropin releasing hormone receptor 2
SynonymsCRF-R2, CRH-R2, Crfr2, CRF 2 receptor, CRFR2beta, CRFR2alpha
MMRRC Submission 043002-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.173) question?
Stock #R5437 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location55090049-55133016 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 55100733 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 196 (V196I)
Ref Sequence ENSEMBL: ENSMUSP00000148297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000003568] [ENSMUST00000095898] [ENSMUST00000114374] [ENSMUST00000164012] [ENSMUST00000212633] [ENSMUST00000213026]
Predicted Effect probably damaging
Transcript: ENSMUST00000003568
AA Change: V215I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000003568
Gene: ENSMUSG00000003476
AA Change: V215I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
HormR 56 127 3.55e-28 SMART
Pfam:7tm_2 132 374 8.4e-79 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000095898
SMART Domains Protein: ENSMUSP00000093586
Gene: ENSMUSG00000003476

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
HormR 36 107 1.75e-27 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000114374
AA Change: V195I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110015
Gene: ENSMUSG00000003476
AA Change: V195I

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
HormR 36 107 3.55e-28 SMART
Pfam:7tm_2 112 354 9.7e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000164012
AA Change: V216I

PolyPhen 2 Score 0.139 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000126673
Gene: ENSMUSG00000003476
AA Change: V216I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
HormR 56 127 3.55e-28 SMART
Pfam:7tm_2 132 374 1e-79 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166954
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169777
Predicted Effect noncoding transcript
Transcript: ENSMUST00000204117
Predicted Effect probably damaging
Transcript: ENSMUST00000212633
AA Change: V216I

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000213026
AA Change: V196I

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.0352 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the G-protein coupled receptor 2 family, and the subfamily of corticotropin releasing hormone receptor. This receptor shows high affinity for corticotropin releasing hormone (CRH), and also binds CRH-related peptides such as urocortin. CRH is synthesized in the hypothalamus, and plays an important role in coordinating the endocrine, autonomic, and behavioral responses to stress and immune challenge. Studies in mice suggest that this receptor maybe involved in mediating cardiovascular homeostasis. Alternatively spliced transcript variants encoding different isoforms have been described for this gene.[provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous inactivation of this gene may result in hypersensitivity to stress, increased anxiety-like behavior, abnormal homeostatic responses to challenges of increased dietary fat and cold, and cardiovascular abnormalities, including hypertension and decreased cardiac contractility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 G A 11: 110,319,796 Q186* probably null Het
Acaca G A 11: 84,346,820 probably null Het
Acsm3 C A 7: 119,778,497 probably benign Het
Aoc1 C A 6: 48,907,750 Q576K probably benign Het
Atp6v0a4 T A 6: 38,076,733 N378I probably damaging Het
BC003331 T G 1: 150,363,518 I385L probably benign Het
Cacna1i A T 15: 80,371,529 H871L probably damaging Het
Clic4 C G 4: 135,217,246 R206P probably damaging Het
Commd9 G A 2: 101,901,028 G186D probably damaging Het
Cpne9 C T 6: 113,304,630 probably benign Het
Dctn5 T A 7: 122,133,329 probably benign Het
Dhtkd1 C T 2: 5,924,119 R247Q probably benign Het
Dmrta1 G A 4: 89,691,756 G318R possibly damaging Het
Dpp6 T A 5: 27,663,501 Y487* probably null Het
Eef1akmt3 A T 10: 127,033,247 N119K probably damaging Het
Eloa A T 4: 136,012,885 L75Q probably damaging Het
Fat3 G A 9: 16,085,308 T1202M probably damaging Het
Fcho2 A G 13: 98,777,474 I205T possibly damaging Het
Fkbp10 A C 11: 100,421,023 D174A probably damaging Het
Gcnt2 T A 13: 40,861,176 F274L probably damaging Het
Gtf3c1 A T 7: 125,667,368 C969S probably damaging Het
Hook3 T C 8: 26,061,422 E130G probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Itsn1 T A 16: 91,818,591 probably benign Het
Kif13b C T 14: 64,806,114 R1788C probably damaging Het
Kif3a C T 11: 53,598,726 S135F probably damaging Het
Klf5 C T 14: 99,301,459 R23* probably null Het
Lcn5 A G 2: 25,658,011 I11V probably benign Het
Mpp7 A T 18: 7,458,930 probably null Het
Mroh5 T C 15: 73,787,969 I338V probably benign Het
Mthfd2l A G 5: 90,948,898 N126S possibly damaging Het
Myo18b G T 5: 112,757,573 A2053E possibly damaging Het
Naip6 A T 13: 100,303,304 C318* probably null Het
Ndufs7 C T 10: 80,254,924 R116C possibly damaging Het
Olfr1378 T C 11: 50,969,108 M30T probably benign Het
Pnkd T C 1: 74,349,737 V214A possibly damaging Het
Popdc2 T G 16: 38,362,901 V82G probably benign Het
Prkdc A T 16: 15,769,875 L2541F possibly damaging Het
Ptpn9 A T 9: 57,020,037 H66L possibly damaging Het
Pygm T A 19: 6,390,382 N397K probably damaging Het
Rabgap1l T A 1: 160,722,147 E324D probably damaging Het
Rnf6 G A 5: 146,210,280 R643C probably damaging Het
Ryr2 C T 13: 11,655,713 V3466M probably damaging Het
Scn7a A G 2: 66,676,346 Y1400H probably damaging Het
Sept10 T A 10: 59,176,959 N279I probably damaging Het
Sh3rf2 A T 18: 42,141,014 Y415F probably benign Het
Sorcs1 T C 19: 50,252,602 T449A probably benign Het
Tcam1 C T 11: 106,285,423 T325M probably damaging Het
Tctn1 A G 5: 122,258,879 I147T probably benign Het
Tet1 G T 10: 62,814,451 H30Q probably benign Het
Tmem109 A G 19: 10,872,014 I159T probably damaging Het
Tmem40 C T 6: 115,759,031 probably benign Het
Tnfrsf21 C T 17: 43,037,862 P122S possibly damaging Het
Uaca A G 9: 60,871,451 D1038G probably benign Het
Ubr2 C G 17: 46,963,697 E852D probably benign Het
Ubr3 A T 2: 69,944,390 N518I probably damaging Het
Unc80 T G 1: 66,654,578 L2596R possibly damaging Het
Zcchc3 G A 2: 152,414,732 P16S probably benign Het
Other mutations in Crhr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02173:Crhr2 APN 6 55103180 missense probably damaging 1.00
R0278:Crhr2 UTSW 6 55117531 missense probably benign 0.16
R1056:Crhr2 UTSW 6 55100735 missense probably damaging 1.00
R1701:Crhr2 UTSW 6 55099270 missense probably damaging 1.00
R1702:Crhr2 UTSW 6 55092535 missense probably damaging 1.00
R2697:Crhr2 UTSW 6 55102830 missense probably damaging 1.00
R4020:Crhr2 UTSW 6 55100780 splice site probably benign
R4030:Crhr2 UTSW 6 55117677 missense probably benign 0.34
R4527:Crhr2 UTSW 6 55132853 utr 5 prime probably benign
R4698:Crhr2 UTSW 6 55102867 missense possibly damaging 0.90
R4737:Crhr2 UTSW 6 55091305 missense probably damaging 1.00
R5718:Crhr2 UTSW 6 55092100 nonsense probably null
R5719:Crhr2 UTSW 6 55103222 missense probably damaging 1.00
R5945:Crhr2 UTSW 6 55100682 missense possibly damaging 0.93
R6046:Crhr2 UTSW 6 55091292 missense probably damaging 1.00
R6358:Crhr2 UTSW 6 55093043 missense probably benign 0.20
R6826:Crhr2 UTSW 6 55117740 intron probably benign
R7011:Crhr2 UTSW 6 55099210 critical splice donor site probably null
R7131:Crhr2 UTSW 6 55092127 missense
Z1088:Crhr2 UTSW 6 55103216 missense possibly damaging 0.69
Predicted Primers PCR Primer
(F):5'- TTGGCCTCAAGATGAAGTGGG -3'
(R):5'- AGCCAACCATTCTCTTTCTAGACTG -3'

Sequencing Primer
(F):5'- GGGAGAGCATGGATTTTATCAAC -3'
(R):5'- AGTTCTGAGCAAACCTGTGC -3'
Posted On2016-09-01