Incidental Mutation 'R5437:Kif3a'
ID428435
Institutional Source Beutler Lab
Gene Symbol Kif3a
Ensembl Gene ENSMUSG00000018395
Gene Namekinesin family member 3A
SynonymsKns3, kinesin-II subunit, N-4 kinesin, Kif3, Kifl
MMRRC Submission 043002-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5437 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location53567379-53601967 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 53598726 bp
ZygosityHeterozygous
Amino Acid Change Serine to Phenylalanine at position 135 (S135F)
Ref Sequence ENSEMBL: ENSMUSP00000116509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000057330] [ENSMUST00000118353] [ENSMUST00000120613] [ENSMUST00000130037] [ENSMUST00000173744]
Predicted Effect probably benign
Transcript: ENSMUST00000057330
AA Change: S648F

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000056197
Gene: ENSMUSG00000018395
AA Change: S648F

DomainStartEndE-ValueType
KISc 12 353 9.79e-187 SMART
coiled coil region 416 593 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000118353
AA Change: S675F

PolyPhen 2 Score 0.734 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000113848
Gene: ENSMUSG00000018395
AA Change: S675F

DomainStartEndE-ValueType
KISc 12 353 9.79e-187 SMART
low complexity region 365 418 N/A INTRINSIC
coiled coil region 443 620 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120613
AA Change: S651F

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112782
Gene: ENSMUSG00000018395
AA Change: S651F

DomainStartEndE-ValueType
KISc 12 353 4.6e-189 SMART
coiled coil region 354 383 N/A INTRINSIC
coiled coil region 419 596 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127858
Predicted Effect probably damaging
Transcript: ENSMUST00000130037
AA Change: S135F

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000116509
Gene: ENSMUSG00000018395
AA Change: S135F

DomainStartEndE-ValueType
SCOP:d1cm5a_ 5 88 2e-3 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000173744
AA Change: S644F

PolyPhen 2 Score 0.978 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000133432
Gene: ENSMUSG00000018395
AA Change: S644F

DomainStartEndE-ValueType
KISc 12 353 9.79e-187 SMART
low complexity region 365 406 N/A INTRINSIC
low complexity region 462 473 N/A INTRINSIC
low complexity region 481 494 N/A INTRINSIC
low complexity region 498 526 N/A INTRINSIC
Meta Mutation Damage Score 0.304 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (63/65)
MGI Phenotype PHENOTYPE: Nullizygous mutations result in embryonic lethality, failure to synthesize cilia in the embryonic node, randomization of left-right asymmetry and structural abnormalities of the neural tube, pericardium, branchial arches, and somites. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 G A 11: 110,319,796 Q186* probably null Het
Acaca G A 11: 84,346,820 probably null Het
Acsm3 C A 7: 119,778,497 probably benign Het
Aoc1 C A 6: 48,907,750 Q576K probably benign Het
Atp6v0a4 T A 6: 38,076,733 N378I probably damaging Het
BC003331 T G 1: 150,363,518 I385L probably benign Het
Cacna1i A T 15: 80,371,529 H871L probably damaging Het
Clic4 C G 4: 135,217,246 R206P probably damaging Het
Commd9 G A 2: 101,901,028 G186D probably damaging Het
Cpne9 C T 6: 113,304,630 probably benign Het
Crhr2 C T 6: 55,100,733 V196I probably damaging Het
Dctn5 T A 7: 122,133,329 probably benign Het
Dhtkd1 C T 2: 5,924,119 R247Q probably benign Het
Dmrta1 G A 4: 89,691,756 G318R possibly damaging Het
Dpp6 T A 5: 27,663,501 Y487* probably null Het
Eef1akmt3 A T 10: 127,033,247 N119K probably damaging Het
Eloa A T 4: 136,012,885 L75Q probably damaging Het
Fat3 G A 9: 16,085,308 T1202M probably damaging Het
Fcho2 A G 13: 98,777,474 I205T possibly damaging Het
Fkbp10 A C 11: 100,421,023 D174A probably damaging Het
Gcnt2 T A 13: 40,861,176 F274L probably damaging Het
Gtf3c1 A T 7: 125,667,368 C969S probably damaging Het
Hook3 T C 8: 26,061,422 E130G probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Itsn1 T A 16: 91,818,591 probably benign Het
Kif13b C T 14: 64,806,114 R1788C probably damaging Het
Klf5 C T 14: 99,301,459 R23* probably null Het
Lcn5 A G 2: 25,658,011 I11V probably benign Het
Mpp7 A T 18: 7,458,930 probably null Het
Mroh5 T C 15: 73,787,969 I338V probably benign Het
Mthfd2l A G 5: 90,948,898 N126S possibly damaging Het
Myo18b G T 5: 112,757,573 A2053E possibly damaging Het
Naip6 A T 13: 100,303,304 C318* probably null Het
Ndufs7 C T 10: 80,254,924 R116C possibly damaging Het
Olfr1378 T C 11: 50,969,108 M30T probably benign Het
Pnkd T C 1: 74,349,737 V214A possibly damaging Het
Popdc2 T G 16: 38,362,901 V82G probably benign Het
Prkdc A T 16: 15,769,875 L2541F possibly damaging Het
Ptpn9 A T 9: 57,020,037 H66L possibly damaging Het
Pygm T A 19: 6,390,382 N397K probably damaging Het
Rabgap1l T A 1: 160,722,147 E324D probably damaging Het
Rnf6 G A 5: 146,210,280 R643C probably damaging Het
Ryr2 C T 13: 11,655,713 V3466M probably damaging Het
Scn7a A G 2: 66,676,346 Y1400H probably damaging Het
Sept10 T A 10: 59,176,959 N279I probably damaging Het
Sh3rf2 A T 18: 42,141,014 Y415F probably benign Het
Sorcs1 T C 19: 50,252,602 T449A probably benign Het
Tcam1 C T 11: 106,285,423 T325M probably damaging Het
Tctn1 A G 5: 122,258,879 I147T probably benign Het
Tet1 G T 10: 62,814,451 H30Q probably benign Het
Tmem109 A G 19: 10,872,014 I159T probably damaging Het
Tmem40 C T 6: 115,759,031 probably benign Het
Tnfrsf21 C T 17: 43,037,862 P122S possibly damaging Het
Uaca A G 9: 60,871,451 D1038G probably benign Het
Ubr2 C G 17: 46,963,697 E852D probably benign Het
Ubr3 A T 2: 69,944,390 N518I probably damaging Het
Unc80 T G 1: 66,654,578 L2596R possibly damaging Het
Zcchc3 G A 2: 152,414,732 P16S probably benign Het
Other mutations in Kif3a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Kif3a APN 11 53593523 missense possibly damaging 0.53
IGL01862:Kif3a APN 11 53570541 missense possibly damaging 0.63
IGL02411:Kif3a APN 11 53570698 missense probably damaging 1.00
PIT4453001:Kif3a UTSW 11 53579114 missense probably benign 0.16
R0049:Kif3a UTSW 11 53590733 splice site probably benign
R0049:Kif3a UTSW 11 53590733 splice site probably benign
R0078:Kif3a UTSW 11 53578985 missense probably benign 0.22
R0131:Kif3a UTSW 11 53586916 missense possibly damaging 0.53
R1079:Kif3a UTSW 11 53570581 missense possibly damaging 0.87
R1168:Kif3a UTSW 11 53598312 missense probably damaging 1.00
R1554:Kif3a UTSW 11 53598327 missense probably damaging 0.98
R1817:Kif3a UTSW 11 53598734 missense probably damaging 1.00
R2022:Kif3a UTSW 11 53570581 missense probably damaging 1.00
R2964:Kif3a UTSW 11 53578930 missense probably damaging 1.00
R3861:Kif3a UTSW 11 53597978 missense probably benign 0.33
R3928:Kif3a UTSW 11 53570614 missense probably benign 0.02
R4553:Kif3a UTSW 11 53578918 missense possibly damaging 0.93
R5158:Kif3a UTSW 11 53588751 missense probably benign
R6621:Kif3a UTSW 11 53579130 missense probably damaging 1.00
R7028:Kif3a UTSW 11 53586906 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACTGCATGACTCTGGTTTG -3'
(R):5'- TGACTGCCTTTGAGTGTAGC -3'

Sequencing Primer
(F):5'- TAGAACAGGCCTGCTCTCCAG -3'
(R):5'- GACTGCCTTTGAGTGTAGCTAAATC -3'
Posted On2016-09-01