Incidental Mutation 'R5437:Itgb4'
List |< first << previous [record 24 of 59] next >> last >|
ID428439
Institutional Source Beutler Lab
Gene Symbol Itgb4
Ensembl Gene ENSMUSG00000020758
Gene Nameintegrin beta 4
SynonymsCD104
MMRRC Submission 043002-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5437 (G1)
Quality Score221
Status Validated
Chromosome11
Chromosomal Location115974709-116008412 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 115984157 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 447 (R447W)
Ref Sequence ENSEMBL: ENSMUSP00000127604 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021107] [ENSMUST00000068981] [ENSMUST00000106458] [ENSMUST00000106460] [ENSMUST00000106461] [ENSMUST00000169928]
Predicted Effect probably benign
Transcript: ENSMUST00000021107
AA Change: R447W

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000021107
Gene: ENSMUSG00000020758
AA Change: R447W

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 712 1.32e-28 SMART
low complexity region 715 732 N/A INTRINSIC
transmembrane domain 737 756 N/A INTRINSIC
Calx_beta 980 1085 3.13e-35 SMART
FN3 1125 1203 3.15e-8 SMART
FN3 1218 1305 6.29e-8 SMART
low complexity region 1324 1332 N/A INTRINSIC
FN3 1508 1589 1.79e-12 SMART
FN3 1621 1705 1.7e-13 SMART
low complexity region 1738 1751 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000068981
AA Change: R447W

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000070811
Gene: ENSMUSG00000020758
AA Change: R447W

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 713 7.06e-29 SMART
low complexity region 716 733 N/A INTRINSIC
transmembrane domain 738 757 N/A INTRINSIC
Calx_beta 981 1086 3.13e-35 SMART
FN3 1129 1207 3.15e-8 SMART
FN3 1222 1309 6.29e-8 SMART
low complexity region 1328 1336 N/A INTRINSIC
FN3 1459 1540 1.79e-12 SMART
FN3 1572 1656 1.7e-13 SMART
low complexity region 1689 1702 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106458
AA Change: R447W

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102066
Gene: ENSMUSG00000020758
AA Change: R447W

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 713 7.06e-29 SMART
low complexity region 716 733 N/A INTRINSIC
transmembrane domain 738 757 N/A INTRINSIC
Calx_beta 981 1086 3.13e-35 SMART
FN3 1129 1207 3.15e-8 SMART
FN3 1222 1309 6.29e-8 SMART
low complexity region 1328 1336 N/A INTRINSIC
low complexity region 1413 1425 N/A INTRINSIC
FN3 1524 1605 1.79e-12 SMART
FN3 1637 1721 1.7e-13 SMART
low complexity region 1754 1767 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106460
AA Change: R447W

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102068
Gene: ENSMUSG00000020758
AA Change: R447W

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 713 7.06e-29 SMART
low complexity region 716 733 N/A INTRINSIC
transmembrane domain 738 757 N/A INTRINSIC
Calx_beta 981 1086 3.13e-35 SMART
FN3 1129 1207 3.15e-8 SMART
FN3 1222 1309 6.29e-8 SMART
low complexity region 1328 1336 N/A INTRINSIC
FN3 1512 1593 1.79e-12 SMART
FN3 1625 1709 1.7e-13 SMART
low complexity region 1742 1755 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106461
AA Change: R447W

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000102069
Gene: ENSMUSG00000020758
AA Change: R447W

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 713 7.06e-29 SMART
low complexity region 716 733 N/A INTRINSIC
transmembrane domain 738 757 N/A INTRINSIC
Calx_beta 981 1086 3.13e-35 SMART
FN3 1129 1207 3.15e-8 SMART
FN3 1222 1309 6.29e-8 SMART
low complexity region 1328 1336 N/A INTRINSIC
low complexity region 1413 1425 N/A INTRINSIC
FN3 1524 1605 1.79e-12 SMART
FN3 1637 1721 1.7e-13 SMART
low complexity region 1754 1767 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151691
Predicted Effect probably benign
Transcript: ENSMUST00000169928
AA Change: R447W

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000127604
Gene: ENSMUSG00000020758
AA Change: R447W

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
PSI 30 74 3.89e-1 SMART
INB 38 457 4.23e-213 SMART
VWA 130 361 8.29e-1 SMART
EGF_like 544 576 3.23e1 SMART
Integrin_B_tail 628 712 1.32e-28 SMART
low complexity region 715 732 N/A INTRINSIC
transmembrane domain 737 756 N/A INTRINSIC
Calx_beta 980 1085 3.13e-35 SMART
FN3 1125 1203 3.15e-8 SMART
FN3 1218 1305 6.29e-8 SMART
low complexity region 1324 1332 N/A INTRINSIC
FN3 1508 1589 1.79e-12 SMART
FN3 1621 1705 1.7e-13 SMART
low complexity region 1738 1751 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180782
Meta Mutation Damage Score 0.0484 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: Integrins are heterodimers comprised of alpha and beta subunits, that are noncovalently associated transmembrane glycoprotein receptors. Different combinations of alpha and beta polypeptides form complexes that vary in their ligand-binding specificities. Integrins mediate cell-matrix or cell-cell adhesion, and transduced signals that regulate gene expression and cell growth. This gene encodes the integrin beta 4 subunit, a receptor for the laminins. This subunit tends to associate with alpha 6 subunit and is likely to play a pivotal role in the biology of invasive carcinoma. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations die shortly after birth with extensive detachment of the epidermis and other squamus epithelia. Stratified tissues lack hemidesmosomes and simple epithelia are also defective in adherence. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 G A 11: 110,319,796 Q186* probably null Het
Acaca G A 11: 84,346,820 probably null Het
Acsm3 C A 7: 119,778,497 probably benign Het
Aoc1 C A 6: 48,907,750 Q576K probably benign Het
Atp6v0a4 T A 6: 38,076,733 N378I probably damaging Het
BC003331 T G 1: 150,363,518 I385L probably benign Het
Cacna1i A T 15: 80,371,529 H871L probably damaging Het
Clic4 C G 4: 135,217,246 R206P probably damaging Het
Commd9 G A 2: 101,901,028 G186D probably damaging Het
Cpne9 C T 6: 113,304,630 probably benign Het
Crhr2 C T 6: 55,100,733 V196I probably damaging Het
Dctn5 T A 7: 122,133,329 probably benign Het
Dhtkd1 C T 2: 5,924,119 R247Q probably benign Het
Dmrta1 G A 4: 89,691,756 G318R possibly damaging Het
Dpp6 T A 5: 27,663,501 Y487* probably null Het
Eef1akmt3 A T 10: 127,033,247 N119K probably damaging Het
Eloa A T 4: 136,012,885 L75Q probably damaging Het
Fat3 G A 9: 16,085,308 T1202M probably damaging Het
Fcho2 A G 13: 98,777,474 I205T possibly damaging Het
Fkbp10 A C 11: 100,421,023 D174A probably damaging Het
Gcnt2 T A 13: 40,861,176 F274L probably damaging Het
Gtf3c1 A T 7: 125,667,368 C969S probably damaging Het
Hook3 T C 8: 26,061,422 E130G probably benign Het
Itsn1 T A 16: 91,818,591 probably benign Het
Kif13b C T 14: 64,806,114 R1788C probably damaging Het
Kif3a C T 11: 53,598,726 S135F probably damaging Het
Klf5 C T 14: 99,301,459 R23* probably null Het
Lcn5 A G 2: 25,658,011 I11V probably benign Het
Mpp7 A T 18: 7,458,930 probably null Het
Mroh5 T C 15: 73,787,969 I338V probably benign Het
Mthfd2l A G 5: 90,948,898 N126S possibly damaging Het
Myo18b G T 5: 112,757,573 A2053E possibly damaging Het
Naip6 A T 13: 100,303,304 C318* probably null Het
Ndufs7 C T 10: 80,254,924 R116C possibly damaging Het
Olfr1378 T C 11: 50,969,108 M30T probably benign Het
Pnkd T C 1: 74,349,737 V214A possibly damaging Het
Popdc2 T G 16: 38,362,901 V82G probably benign Het
Prkdc A T 16: 15,769,875 L2541F possibly damaging Het
Ptpn9 A T 9: 57,020,037 H66L possibly damaging Het
Pygm T A 19: 6,390,382 N397K probably damaging Het
Rabgap1l T A 1: 160,722,147 E324D probably damaging Het
Rnf6 G A 5: 146,210,280 R643C probably damaging Het
Ryr2 C T 13: 11,655,713 V3466M probably damaging Het
Scn7a A G 2: 66,676,346 Y1400H probably damaging Het
Sept10 T A 10: 59,176,959 N279I probably damaging Het
Sh3rf2 A T 18: 42,141,014 Y415F probably benign Het
Sorcs1 T C 19: 50,252,602 T449A probably benign Het
Tcam1 C T 11: 106,285,423 T325M probably damaging Het
Tctn1 A G 5: 122,258,879 I147T probably benign Het
Tet1 G T 10: 62,814,451 H30Q probably benign Het
Tmem109 A G 19: 10,872,014 I159T probably damaging Het
Tmem40 C T 6: 115,759,031 probably benign Het
Tnfrsf21 C T 17: 43,037,862 P122S possibly damaging Het
Uaca A G 9: 60,871,451 D1038G probably benign Het
Ubr2 C G 17: 46,963,697 E852D probably benign Het
Ubr3 A T 2: 69,944,390 N518I probably damaging Het
Unc80 T G 1: 66,654,578 L2596R possibly damaging Het
Zcchc3 G A 2: 152,414,732 P16S probably benign Het
Other mutations in Itgb4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01360:Itgb4 APN 11 115990940 missense probably damaging 1.00
IGL01391:Itgb4 APN 11 115990920 missense probably damaging 1.00
IGL01431:Itgb4 APN 11 116006457 splice site probably benign
IGL01750:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL01752:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL01756:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL01766:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL01769:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL02188:Itgb4 APN 11 116003387 missense probably benign 0.08
IGL02262:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL02293:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL02318:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL02319:Itgb4 APN 11 115988926 missense probably damaging 0.99
IGL02338:Itgb4 APN 11 116007969 missense probably damaging 1.00
IGL02734:Itgb4 APN 11 116005966 missense probably benign
IGL02879:Itgb4 APN 11 115994352 missense probably benign 0.05
IGL02889:Itgb4 APN 11 115988905 missense probably damaging 1.00
IGL03183:Itgb4 APN 11 115988724 missense probably damaging 1.00
IGL03054:Itgb4 UTSW 11 116000340 nonsense probably null
R0021:Itgb4 UTSW 11 115979627 missense possibly damaging 0.95
R0092:Itgb4 UTSW 11 115979124 missense probably damaging 1.00
R0305:Itgb4 UTSW 11 115979412 missense probably damaging 1.00
R0408:Itgb4 UTSW 11 116007602 missense probably damaging 0.99
R0465:Itgb4 UTSW 11 115979756 missense probably damaging 1.00
R0499:Itgb4 UTSW 11 115979695 missense probably benign 0.00
R0535:Itgb4 UTSW 11 115991009 missense possibly damaging 0.86
R0571:Itgb4 UTSW 11 115979768 missense possibly damaging 0.94
R0613:Itgb4 UTSW 11 115993342 missense probably damaging 0.98
R0838:Itgb4 UTSW 11 115998162 intron probably benign
R1381:Itgb4 UTSW 11 115994337 missense probably benign 0.00
R1451:Itgb4 UTSW 11 115990884 missense probably damaging 1.00
R1459:Itgb4 UTSW 11 115979111 missense probably benign 0.42
R1460:Itgb4 UTSW 11 115984164 missense probably damaging 0.96
R1473:Itgb4 UTSW 11 115984047 missense probably benign 0.01
R1484:Itgb4 UTSW 11 115999799 missense probably benign 0.01
R1593:Itgb4 UTSW 11 115980991 missense probably damaging 1.00
R1623:Itgb4 UTSW 11 115991316 nonsense probably null
R1633:Itgb4 UTSW 11 116007760 missense probably damaging 1.00
R1642:Itgb4 UTSW 11 116007357 missense probably damaging 1.00
R1669:Itgb4 UTSW 11 115991330 missense probably benign 0.07
R1713:Itgb4 UTSW 11 116003489 missense probably damaging 1.00
R1732:Itgb4 UTSW 11 115988918 missense probably damaging 1.00
R1791:Itgb4 UTSW 11 115988520 missense probably damaging 1.00
R1847:Itgb4 UTSW 11 115983764 missense probably benign 0.31
R1902:Itgb4 UTSW 11 115980738 missense probably damaging 0.98
R1945:Itgb4 UTSW 11 115993453 nonsense probably null
R2102:Itgb4 UTSW 11 116005735 missense probably benign 0.23
R2184:Itgb4 UTSW 11 115979624 missense probably damaging 0.96
R2334:Itgb4 UTSW 11 115993435 missense probably damaging 1.00
R2401:Itgb4 UTSW 11 116006563 missense possibly damaging 0.67
R3743:Itgb4 UTSW 11 116003670 missense probably damaging 1.00
R3938:Itgb4 UTSW 11 116005926 missense possibly damaging 0.92
R4134:Itgb4 UTSW 11 116006470 missense probably benign 0.03
R4280:Itgb4 UTSW 11 115990935 missense probably damaging 1.00
R4342:Itgb4 UTSW 11 115988729 missense probably benign 0.01
R4434:Itgb4 UTSW 11 115999814 missense probably benign 0.10
R4505:Itgb4 UTSW 11 115983261 splice site silent
R4585:Itgb4 UTSW 11 115993325 missense probably damaging 1.00
R4586:Itgb4 UTSW 11 115993325 missense probably damaging 1.00
R4601:Itgb4 UTSW 11 116005722 missense probably damaging 1.00
R4921:Itgb4 UTSW 11 116006605 missense probably benign 0.12
R4962:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5027:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5029:Itgb4 UTSW 11 115988591 intron probably benign
R5084:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5085:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5124:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5125:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5150:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5175:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5176:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5179:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5207:Itgb4 UTSW 11 116006539 missense probably damaging 1.00
R5263:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5264:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5334:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5337:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5344:Itgb4 UTSW 11 115989749 missense probably null 0.92
R5391:Itgb4 UTSW 11 115985068 missense probably benign 0.05
R5440:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5653:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5654:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5655:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5772:Itgb4 UTSW 11 115988432 intron probably benign
R5812:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5813:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5814:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5863:Itgb4 UTSW 11 115990922 missense probably damaging 1.00
R5864:Itgb4 UTSW 11 115990922 missense probably damaging 1.00
R5865:Itgb4 UTSW 11 115990922 missense probably damaging 1.00
R5951:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5954:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R5982:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6043:Itgb4 UTSW 11 115979386 missense probably benign 0.30
R6133:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6134:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6135:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6169:Itgb4 UTSW 11 115994276 missense probably damaging 0.98
R6172:Itgb4 UTSW 11 116000411 missense probably benign 0.23
R6255:Itgb4 UTSW 11 115998137 missense possibly damaging 0.83
R6258:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6259:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6260:Itgb4 UTSW 11 115984157 missense probably benign 0.00
R6612:Itgb4 UTSW 11 115984071 missense probably benign 0.00
R7037:Itgb4 UTSW 11 116005565 nonsense probably null
R7371:Itgb4 UTSW 11 115998080 missense probably benign 0.29
X0062:Itgb4 UTSW 11 115993452 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CAAGTCCCTGTCCATACACTG -3'
(R):5'- TGCTCTCTGTGACTTGGGAC -3'

Sequencing Primer
(F):5'- TGAGCGAACAGGCTAATGTC -3'
(R):5'- CCAGGGATGTGTATCCAT -3'
Posted On2016-09-01