Incidental Mutation 'R5437:Cacna1i'
ID428447
Institutional Source Beutler Lab
Gene Symbol Cacna1i
Ensembl Gene ENSMUSG00000022416
Gene Namecalcium channel, voltage-dependent, alpha 1I subunit
Synonyms
MMRRC Submission 043002-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.202) question?
Stock #R5437 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location80287238-80398279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 80371529 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 871 (H871L)
Ref Sequence ENSEMBL: ENSMUSP00000125063 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000160424] [ENSMUST00000162155]
Predicted Effect probably damaging
Transcript: ENSMUST00000160424
AA Change: H871L

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000125063
Gene: ENSMUSG00000022416
AA Change: H871L

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 76 407 1.4e-79 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 597 830 7.4e-58 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1128 1401 7.8e-65 PFAM
Pfam:Ion_trans 1445 1700 9.4e-58 PFAM
Pfam:PKD_channel 1538 1694 1.4e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
low complexity region 1837 1853 N/A INTRINSIC
low complexity region 1922 1933 N/A INTRINSIC
low complexity region 1990 2005 N/A INTRINSIC
low complexity region 2041 2058 N/A INTRINSIC
low complexity region 2087 2097 N/A INTRINSIC
low complexity region 2103 2126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162155
AA Change: H871L

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000125229
Gene: ENSMUSG00000022416
AA Change: H871L

DomainStartEndE-ValueType
low complexity region 2 16 N/A INTRINSIC
low complexity region 24 40 N/A INTRINSIC
Pfam:Ion_trans 115 395 1.9e-66 PFAM
low complexity region 464 482 N/A INTRINSIC
low complexity region 531 554 N/A INTRINSIC
Pfam:Ion_trans 632 819 2.4e-45 PFAM
low complexity region 870 892 N/A INTRINSIC
low complexity region 919 940 N/A INTRINSIC
low complexity region 984 1015 N/A INTRINSIC
low complexity region 1069 1080 N/A INTRINSIC
Pfam:Ion_trans 1165 1389 6.2e-55 PFAM
coiled coil region 1394 1426 N/A INTRINSIC
Pfam:Ion_trans 1480 1688 1.9e-47 PFAM
Pfam:PKD_channel 1538 1694 4.8e-10 PFAM
low complexity region 1718 1739 N/A INTRINSIC
low complexity region 1744 1760 N/A INTRINSIC
Meta Mutation Damage Score 0.294 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the pore-forming alpha subunit of a voltage gated calcium channel. The encoded protein is a member of a subfamily of calcium channels referred to as is a low voltage-activated, T-type, calcium channel. The channel encoded by this protein is characterized by a slower activation and inactivation compared to other T-type calcium channels. This protein may be involved in calcium signaling in neurons. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 G A 11: 110,319,796 Q186* probably null Het
Acaca G A 11: 84,346,820 probably null Het
Acsm3 C A 7: 119,778,497 probably benign Het
Aoc1 C A 6: 48,907,750 Q576K probably benign Het
Atp6v0a4 T A 6: 38,076,733 N378I probably damaging Het
BC003331 T G 1: 150,363,518 I385L probably benign Het
Clic4 C G 4: 135,217,246 R206P probably damaging Het
Commd9 G A 2: 101,901,028 G186D probably damaging Het
Cpne9 C T 6: 113,304,630 probably benign Het
Crhr2 C T 6: 55,100,733 V196I probably damaging Het
Dctn5 T A 7: 122,133,329 probably benign Het
Dhtkd1 C T 2: 5,924,119 R247Q probably benign Het
Dmrta1 G A 4: 89,691,756 G318R possibly damaging Het
Dpp6 T A 5: 27,663,501 Y487* probably null Het
Eef1akmt3 A T 10: 127,033,247 N119K probably damaging Het
Eloa A T 4: 136,012,885 L75Q probably damaging Het
Fat3 G A 9: 16,085,308 T1202M probably damaging Het
Fcho2 A G 13: 98,777,474 I205T possibly damaging Het
Fkbp10 A C 11: 100,421,023 D174A probably damaging Het
Gcnt2 T A 13: 40,861,176 F274L probably damaging Het
Gtf3c1 A T 7: 125,667,368 C969S probably damaging Het
Hook3 T C 8: 26,061,422 E130G probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Itsn1 T A 16: 91,818,591 probably benign Het
Kif13b C T 14: 64,806,114 R1788C probably damaging Het
Kif3a C T 11: 53,598,726 S135F probably damaging Het
Klf5 C T 14: 99,301,459 R23* probably null Het
Lcn5 A G 2: 25,658,011 I11V probably benign Het
Mpp7 A T 18: 7,458,930 probably null Het
Mroh5 T C 15: 73,787,969 I338V probably benign Het
Mthfd2l A G 5: 90,948,898 N126S possibly damaging Het
Myo18b G T 5: 112,757,573 A2053E possibly damaging Het
Naip6 A T 13: 100,303,304 C318* probably null Het
Ndufs7 C T 10: 80,254,924 R116C possibly damaging Het
Olfr1378 T C 11: 50,969,108 M30T probably benign Het
Pnkd T C 1: 74,349,737 V214A possibly damaging Het
Popdc2 T G 16: 38,362,901 V82G probably benign Het
Prkdc A T 16: 15,769,875 L2541F possibly damaging Het
Ptpn9 A T 9: 57,020,037 H66L possibly damaging Het
Pygm T A 19: 6,390,382 N397K probably damaging Het
Rabgap1l T A 1: 160,722,147 E324D probably damaging Het
Rnf6 G A 5: 146,210,280 R643C probably damaging Het
Ryr2 C T 13: 11,655,713 V3466M probably damaging Het
Scn7a A G 2: 66,676,346 Y1400H probably damaging Het
Sept10 T A 10: 59,176,959 N279I probably damaging Het
Sh3rf2 A T 18: 42,141,014 Y415F probably benign Het
Sorcs1 T C 19: 50,252,602 T449A probably benign Het
Tcam1 C T 11: 106,285,423 T325M probably damaging Het
Tctn1 A G 5: 122,258,879 I147T probably benign Het
Tet1 G T 10: 62,814,451 H30Q probably benign Het
Tmem109 A G 19: 10,872,014 I159T probably damaging Het
Tmem40 C T 6: 115,759,031 probably benign Het
Tnfrsf21 C T 17: 43,037,862 P122S possibly damaging Het
Uaca A G 9: 60,871,451 D1038G probably benign Het
Ubr2 C G 17: 46,963,697 E852D probably benign Het
Ubr3 A T 2: 69,944,390 N518I probably damaging Het
Unc80 T G 1: 66,654,578 L2596R possibly damaging Het
Zcchc3 G A 2: 152,414,732 P16S probably benign Het
Other mutations in Cacna1i
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00421:Cacna1i APN 15 80382019 missense probably damaging 1.00
IGL00976:Cacna1i APN 15 80355645 missense probably benign
IGL01338:Cacna1i APN 15 80348380 missense probably damaging 0.99
IGL01589:Cacna1i APN 15 80387759 splice site probably benign
IGL01669:Cacna1i APN 15 80391757 missense probably benign
IGL01807:Cacna1i APN 15 80374147 missense probably damaging 1.00
IGL01911:Cacna1i APN 15 80391732 missense probably benign 0.09
IGL01973:Cacna1i APN 15 80382033 missense probably damaging 1.00
IGL02205:Cacna1i APN 15 80372951 missense probably benign 0.06
IGL02519:Cacna1i APN 15 80361874 nonsense probably null
IGL02648:Cacna1i APN 15 80298638 missense probably damaging 0.96
IGL03033:Cacna1i APN 15 80362239 missense probably damaging 0.98
IGL03214:Cacna1i APN 15 80355716 missense probably benign 0.30
R0067:Cacna1i UTSW 15 80381172 missense probably damaging 1.00
R0067:Cacna1i UTSW 15 80381172 missense probably damaging 1.00
R0295:Cacna1i UTSW 15 80356211 missense probably damaging 1.00
R0345:Cacna1i UTSW 15 80372462 missense probably damaging 0.98
R0415:Cacna1i UTSW 15 80368830 splice site probably benign
R0637:Cacna1i UTSW 15 80372654 missense probably damaging 0.99
R0638:Cacna1i UTSW 15 80381080 missense possibly damaging 0.94
R0840:Cacna1i UTSW 15 80358949 missense possibly damaging 0.85
R1463:Cacna1i UTSW 15 80379054 missense possibly damaging 0.96
R1528:Cacna1i UTSW 15 80391774 splice site probably null
R1563:Cacna1i UTSW 15 80321188 missense probably damaging 0.97
R1563:Cacna1i UTSW 15 80389855 splice site probably benign
R1573:Cacna1i UTSW 15 80393668 splice site probably null
R1654:Cacna1i UTSW 15 80389210 missense probably damaging 1.00
R1754:Cacna1i UTSW 15 80371529 missense probably damaging 0.99
R1794:Cacna1i UTSW 15 80389122 missense probably damaging 1.00
R1824:Cacna1i UTSW 15 80376789 missense possibly damaging 0.64
R1863:Cacna1i UTSW 15 80358931 missense probably damaging 1.00
R1885:Cacna1i UTSW 15 80358944 missense probably damaging 0.99
R1886:Cacna1i UTSW 15 80358944 missense probably damaging 0.99
R1899:Cacna1i UTSW 15 80391642 missense possibly damaging 0.91
R1907:Cacna1i UTSW 15 80375264 missense probably damaging 1.00
R1943:Cacna1i UTSW 15 80395044 missense probably benign
R2162:Cacna1i UTSW 15 80356187 missense probably damaging 1.00
R2888:Cacna1i UTSW 15 80374767 missense probably damaging 1.00
R3701:Cacna1i UTSW 15 80381071 splice site probably benign
R3702:Cacna1i UTSW 15 80381071 splice site probably benign
R3832:Cacna1i UTSW 15 80356187 missense probably damaging 1.00
R4852:Cacna1i UTSW 15 80388479 missense probably damaging 0.99
R4857:Cacna1i UTSW 15 80369662 missense probably damaging 1.00
R4950:Cacna1i UTSW 15 80368671 missense probably damaging 1.00
R4980:Cacna1i UTSW 15 80348449 missense probably damaging 0.97
R5217:Cacna1i UTSW 15 80390840 missense possibly damaging 0.94
R5519:Cacna1i UTSW 15 80371499 missense probably damaging 1.00
R5642:Cacna1i UTSW 15 80395078 missense possibly damaging 0.47
R6217:Cacna1i UTSW 15 80389132 missense probably damaging 1.00
R6225:Cacna1i UTSW 15 80321226 missense probably damaging 1.00
R6251:Cacna1i UTSW 15 80336682 missense probably damaging 1.00
R6463:Cacna1i UTSW 15 80355758 missense probably damaging 0.97
R6490:Cacna1i UTSW 15 80378247 missense probably damaging 1.00
R6613:Cacna1i UTSW 15 80321259 missense probably damaging 1.00
R6884:Cacna1i UTSW 15 80374809 missense probably damaging 1.00
R6904:Cacna1i UTSW 15 80374801 missense probably damaging 1.00
R7017:Cacna1i UTSW 15 80380470 missense probably damaging 1.00
X0022:Cacna1i UTSW 15 80361962 missense probably damaging 0.99
X0024:Cacna1i UTSW 15 80362139 missense probably benign 0.03
X0058:Cacna1i UTSW 15 80379102 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGGTGGAGAACATCACAC -3'
(R):5'- TGCCACAGTCTTTCAGTGCC -3'

Sequencing Primer
(F):5'- TGGAGAACATCACACCAGAAAAGTTC -3'
(R):5'- GCGAGCATCCATCACAGG -3'
Posted On2016-09-01