Incidental Mutation 'R5437:Popdc2'
ID428449
Institutional Source Beutler Lab
Gene Symbol Popdc2
Ensembl Gene ENSMUSG00000022803
Gene Namepopeye domain containing 2
SynonymsPop2
MMRRC Submission 043002-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5437 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location38362209-38378216 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 38362901 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glycine at position 82 (V82G)
Ref Sequence ENSEMBL: ENSMUSP00000110387 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023494] [ENSMUST00000114739] [ENSMUST00000119704]
Predicted Effect probably benign
Transcript: ENSMUST00000023494
AA Change: V82G

PolyPhen 2 Score 0.354 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000023494
Gene: ENSMUSG00000022803
AA Change: V82G

DomainStartEndE-ValueType
Pfam:Popeye 25 251 6.9e-98 PFAM
low complexity region 306 317 N/A INTRINSIC
low complexity region 320 334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000114739
AA Change: V82G

PolyPhen 2 Score 0.354 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000110387
Gene: ENSMUSG00000022803
AA Change: V82G

DomainStartEndE-ValueType
transmembrane domain 48 70 N/A INTRINSIC
transmembrane domain 77 99 N/A INTRINSIC
Pfam:Popeye 107 260 2.8e-76 PFAM
low complexity region 306 317 N/A INTRINSIC
low complexity region 320 334 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119704
SMART Domains Protein: ENSMUSP00000112386
Gene: ENSMUSG00000095464

DomainStartEndE-ValueType
Pfam:COX17 18 63 3.4e-25 PFAM
Meta Mutation Damage Score 0.1276 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: This gene encodes a member of the Popeye domain containing family of membrane proteins. Proteins of this family contain three helical transmembrane domains and a conserved intracellular Popeye domain. In the adult mouse, this gene is expressed at high levels in cardiac myocytes, and mice deficient for this gene develop stress-induced cardiac pacemaker dysfunction. The protein binds to a two-pore domain potassium channel and recruits it to the plasma membrane. Cyclic adenosine monophosphate negatively regulates this interaction through the Popeye domain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit sinus brachycardia in response to physical or mental stress and catecholamines with a compact sinoatrial node. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 G A 11: 110,319,796 Q186* probably null Het
Acaca G A 11: 84,346,820 probably null Het
Acsm3 C A 7: 119,778,497 probably benign Het
Aoc1 C A 6: 48,907,750 Q576K probably benign Het
Atp6v0a4 T A 6: 38,076,733 N378I probably damaging Het
BC003331 T G 1: 150,363,518 I385L probably benign Het
Cacna1i A T 15: 80,371,529 H871L probably damaging Het
Clic4 C G 4: 135,217,246 R206P probably damaging Het
Commd9 G A 2: 101,901,028 G186D probably damaging Het
Cpne9 C T 6: 113,304,630 probably benign Het
Crhr2 C T 6: 55,100,733 V196I probably damaging Het
Dctn5 T A 7: 122,133,329 probably benign Het
Dhtkd1 C T 2: 5,924,119 R247Q probably benign Het
Dmrta1 G A 4: 89,691,756 G318R possibly damaging Het
Dpp6 T A 5: 27,663,501 Y487* probably null Het
Eef1akmt3 A T 10: 127,033,247 N119K probably damaging Het
Eloa A T 4: 136,012,885 L75Q probably damaging Het
Fat3 G A 9: 16,085,308 T1202M probably damaging Het
Fcho2 A G 13: 98,777,474 I205T possibly damaging Het
Fkbp10 A C 11: 100,421,023 D174A probably damaging Het
Gcnt2 T A 13: 40,861,176 F274L probably damaging Het
Gtf3c1 A T 7: 125,667,368 C969S probably damaging Het
Hook3 T C 8: 26,061,422 E130G probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Itsn1 T A 16: 91,818,591 probably benign Het
Kif13b C T 14: 64,806,114 R1788C probably damaging Het
Kif3a C T 11: 53,598,726 S135F probably damaging Het
Klf5 C T 14: 99,301,459 R23* probably null Het
Lcn5 A G 2: 25,658,011 I11V probably benign Het
Mpp7 A T 18: 7,458,930 probably null Het
Mroh5 T C 15: 73,787,969 I338V probably benign Het
Mthfd2l A G 5: 90,948,898 N126S possibly damaging Het
Myo18b G T 5: 112,757,573 A2053E possibly damaging Het
Naip6 A T 13: 100,303,304 C318* probably null Het
Ndufs7 C T 10: 80,254,924 R116C possibly damaging Het
Olfr1378 T C 11: 50,969,108 M30T probably benign Het
Pnkd T C 1: 74,349,737 V214A possibly damaging Het
Prkdc A T 16: 15,769,875 L2541F possibly damaging Het
Ptpn9 A T 9: 57,020,037 H66L possibly damaging Het
Pygm T A 19: 6,390,382 N397K probably damaging Het
Rabgap1l T A 1: 160,722,147 E324D probably damaging Het
Rnf6 G A 5: 146,210,280 R643C probably damaging Het
Ryr2 C T 13: 11,655,713 V3466M probably damaging Het
Scn7a A G 2: 66,676,346 Y1400H probably damaging Het
Sept10 T A 10: 59,176,959 N279I probably damaging Het
Sh3rf2 A T 18: 42,141,014 Y415F probably benign Het
Sorcs1 T C 19: 50,252,602 T449A probably benign Het
Tcam1 C T 11: 106,285,423 T325M probably damaging Het
Tctn1 A G 5: 122,258,879 I147T probably benign Het
Tet1 G T 10: 62,814,451 H30Q probably benign Het
Tmem109 A G 19: 10,872,014 I159T probably damaging Het
Tmem40 C T 6: 115,759,031 probably benign Het
Tnfrsf21 C T 17: 43,037,862 P122S possibly damaging Het
Uaca A G 9: 60,871,451 D1038G probably benign Het
Ubr2 C G 17: 46,963,697 E852D probably benign Het
Ubr3 A T 2: 69,944,390 N518I probably damaging Het
Unc80 T G 1: 66,654,578 L2596R possibly damaging Het
Zcchc3 G A 2: 152,414,732 P16S probably benign Het
Other mutations in Popdc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Popdc2 APN 16 38373965 missense probably damaging 1.00
IGL01392:Popdc2 APN 16 38374131 missense probably benign
IGL03001:Popdc2 APN 16 38369519 missense probably benign 0.09
IGL03088:Popdc2 APN 16 38373822 missense probably damaging 1.00
R1698:Popdc2 UTSW 16 38369491 missense probably damaging 1.00
R2152:Popdc2 UTSW 16 38363120 missense possibly damaging 0.78
R2158:Popdc2 UTSW 16 38362826 missense probably damaging 1.00
R4664:Popdc2 UTSW 16 38374287 missense probably damaging 0.97
R5748:Popdc2 UTSW 16 38374303 missense probably damaging 1.00
R7036:Popdc2 UTSW 16 38362811 missense probably damaging 1.00
R7037:Popdc2 UTSW 16 38374267 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCAAAGATGAGTGCCAATGG -3'
(R):5'- AGCGTCAAGACCTGCTCATG -3'

Sequencing Primer
(F):5'- TGTGCAGGAGCTGGAAACC -3'
(R):5'- CTCATGGCAGCAGTGGACAATC -3'
Posted On2016-09-01