Incidental Mutation 'R5437:Sh3rf2'
ID428453
Institutional Source Beutler Lab
Gene Symbol Sh3rf2
Ensembl Gene ENSMUSG00000057719
Gene NameSH3 domain containing ring finger 2
Synonyms9130023G24Rik, RNF158
MMRRC Submission 043002-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5437 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location42053667-42158960 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 42141014 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 415 (Y415F)
Ref Sequence ENSEMBL: ENSMUSP00000071896 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072008] [ENSMUST00000074679]
PDB Structure
Solution structure of the SH3 domain of the mouse hypothetical protein SH3RF2 [SOLUTION NMR]
The solution structure of the first SH3 domain of mouse SH3 domain containing ring finger 2 [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000072008
AA Change: Y415F

PolyPhen 2 Score 0.440 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000071896
Gene: ENSMUSG00000057719
AA Change: Y415F

DomainStartEndE-ValueType
RING 12 52 7.38e-8 SMART
low complexity region 63 73 N/A INTRINSIC
SH3 128 183 4.66e-17 SMART
SH3 190 251 1.45e-13 SMART
low complexity region 357 366 N/A INTRINSIC
SH3 385 442 3.27e-12 SMART
low complexity region 500 514 N/A INTRINSIC
low complexity region 614 631 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000074679
AA Change: Y383F

PolyPhen 2 Score 0.385 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000074247
Gene: ENSMUSG00000057719
AA Change: Y383F

DomainStartEndE-ValueType
RING 12 52 7.38e-8 SMART
low complexity region 63 73 N/A INTRINSIC
SH3 128 183 4.66e-17 SMART
low complexity region 325 334 N/A INTRINSIC
SH3 353 410 3.27e-12 SMART
low complexity region 468 482 N/A INTRINSIC
low complexity region 582 599 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128066
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132681
Meta Mutation Damage Score 0.1216 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (63/65)
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 G A 11: 110,319,796 Q186* probably null Het
Acaca G A 11: 84,346,820 probably null Het
Acsm3 C A 7: 119,778,497 probably benign Het
Aoc1 C A 6: 48,907,750 Q576K probably benign Het
Atp6v0a4 T A 6: 38,076,733 N378I probably damaging Het
BC003331 T G 1: 150,363,518 I385L probably benign Het
Cacna1i A T 15: 80,371,529 H871L probably damaging Het
Clic4 C G 4: 135,217,246 R206P probably damaging Het
Commd9 G A 2: 101,901,028 G186D probably damaging Het
Cpne9 C T 6: 113,304,630 probably benign Het
Crhr2 C T 6: 55,100,733 V196I probably damaging Het
Dctn5 T A 7: 122,133,329 probably benign Het
Dhtkd1 C T 2: 5,924,119 R247Q probably benign Het
Dmrta1 G A 4: 89,691,756 G318R possibly damaging Het
Dpp6 T A 5: 27,663,501 Y487* probably null Het
Eef1akmt3 A T 10: 127,033,247 N119K probably damaging Het
Eloa A T 4: 136,012,885 L75Q probably damaging Het
Fat3 G A 9: 16,085,308 T1202M probably damaging Het
Fcho2 A G 13: 98,777,474 I205T possibly damaging Het
Fkbp10 A C 11: 100,421,023 D174A probably damaging Het
Gcnt2 T A 13: 40,861,176 F274L probably damaging Het
Gtf3c1 A T 7: 125,667,368 C969S probably damaging Het
Hook3 T C 8: 26,061,422 E130G probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Itsn1 T A 16: 91,818,591 probably benign Het
Kif13b C T 14: 64,806,114 R1788C probably damaging Het
Kif3a C T 11: 53,598,726 S135F probably damaging Het
Klf5 C T 14: 99,301,459 R23* probably null Het
Lcn5 A G 2: 25,658,011 I11V probably benign Het
Mpp7 A T 18: 7,458,930 probably null Het
Mroh5 T C 15: 73,787,969 I338V probably benign Het
Mthfd2l A G 5: 90,948,898 N126S possibly damaging Het
Myo18b G T 5: 112,757,573 A2053E possibly damaging Het
Naip6 A T 13: 100,303,304 C318* probably null Het
Ndufs7 C T 10: 80,254,924 R116C possibly damaging Het
Olfr1378 T C 11: 50,969,108 M30T probably benign Het
Pnkd T C 1: 74,349,737 V214A possibly damaging Het
Popdc2 T G 16: 38,362,901 V82G probably benign Het
Prkdc A T 16: 15,769,875 L2541F possibly damaging Het
Ptpn9 A T 9: 57,020,037 H66L possibly damaging Het
Pygm T A 19: 6,390,382 N397K probably damaging Het
Rabgap1l T A 1: 160,722,147 E324D probably damaging Het
Rnf6 G A 5: 146,210,280 R643C probably damaging Het
Ryr2 C T 13: 11,655,713 V3466M probably damaging Het
Scn7a A G 2: 66,676,346 Y1400H probably damaging Het
Sept10 T A 10: 59,176,959 N279I probably damaging Het
Sorcs1 T C 19: 50,252,602 T449A probably benign Het
Tcam1 C T 11: 106,285,423 T325M probably damaging Het
Tctn1 A G 5: 122,258,879 I147T probably benign Het
Tet1 G T 10: 62,814,451 H30Q probably benign Het
Tmem109 A G 19: 10,872,014 I159T probably damaging Het
Tmem40 C T 6: 115,759,031 probably benign Het
Tnfrsf21 C T 17: 43,037,862 P122S possibly damaging Het
Uaca A G 9: 60,871,451 D1038G probably benign Het
Ubr2 C G 17: 46,963,697 E852D probably benign Het
Ubr3 A T 2: 69,944,390 N518I probably damaging Het
Unc80 T G 1: 66,654,578 L2596R possibly damaging Het
Zcchc3 G A 2: 152,414,732 P16S probably benign Het
Other mutations in Sh3rf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00977:Sh3rf2 APN 18 42111218 missense probably benign 0.00
IGL01012:Sh3rf2 APN 18 42054192 missense possibly damaging 0.50
IGL01286:Sh3rf2 APN 18 42139611 critical splice donor site probably null
IGL02369:Sh3rf2 APN 18 42156157 nonsense probably null
IGL02563:Sh3rf2 APN 18 42156142 missense probably damaging 0.99
PIT4445001:Sh3rf2 UTSW 18 42153164 missense probably benign 0.00
R0141:Sh3rf2 UTSW 18 42156057 missense probably benign 0.02
R0270:Sh3rf2 UTSW 18 42104081 missense probably damaging 0.99
R1447:Sh3rf2 UTSW 18 42101671 missense probably benign 0.00
R1491:Sh3rf2 UTSW 18 42053939 missense probably damaging 0.99
R1539:Sh3rf2 UTSW 18 42149822 missense probably damaging 1.00
R1595:Sh3rf2 UTSW 18 42111288 missense probably damaging 1.00
R1749:Sh3rf2 UTSW 18 42153294 missense probably damaging 1.00
R1864:Sh3rf2 UTSW 18 42053981 missense probably damaging 0.99
R1942:Sh3rf2 UTSW 18 42149624 missense probably damaging 1.00
R1998:Sh3rf2 UTSW 18 42141083 missense probably damaging 0.99
R2331:Sh3rf2 UTSW 18 42053863 missense probably benign 0.04
R2680:Sh3rf2 UTSW 18 42101650 missense probably damaging 0.98
R2938:Sh3rf2 UTSW 18 42149724 missense probably benign 0.09
R2940:Sh3rf2 UTSW 18 42111440 critical splice donor site probably null
R3753:Sh3rf2 UTSW 18 42111308 missense probably damaging 1.00
R3861:Sh3rf2 UTSW 18 42153319 missense probably damaging 1.00
R4322:Sh3rf2 UTSW 18 42111399 missense probably damaging 1.00
R5076:Sh3rf2 UTSW 18 42053924 missense probably damaging 1.00
R5169:Sh3rf2 UTSW 18 42153061 missense probably benign 0.00
R5228:Sh3rf2 UTSW 18 42153181 missense possibly damaging 0.69
R5792:Sh3rf2 UTSW 18 42111138 missense probably damaging 0.99
R5820:Sh3rf2 UTSW 18 42141047 missense possibly damaging 0.94
R6159:Sh3rf2 UTSW 18 42156135 missense probably damaging 0.96
R6366:Sh3rf2 UTSW 18 42153065 missense probably benign 0.00
R6640:Sh3rf2 UTSW 18 42101640 missense probably damaging 1.00
R6897:Sh3rf2 UTSW 18 42101605 missense possibly damaging 0.91
R6995:Sh3rf2 UTSW 18 42101541 missense probably damaging 1.00
R7097:Sh3rf2 UTSW 18 42104162 splice site probably null
R7122:Sh3rf2 UTSW 18 42104162 splice site probably null
Predicted Primers PCR Primer
(F):5'- TCCGCCTTCCATGGTTAAG -3'
(R):5'- GTGAAGGCAAAAGTTATTACTTGGC -3'

Sequencing Primer
(F):5'- TGCTGGCAGGTGAGCTACAG -3'
(R):5'- TGGCTTGTACTCTGAAAAAGACACG -3'
Posted On2016-09-01