Incidental Mutation 'R5437:Sorcs1'
ID428456
Institutional Source Beutler Lab
Gene Symbol Sorcs1
Ensembl Gene ENSMUSG00000043531
Gene Namesortilin-related VPS10 domain containing receptor 1
Synonyms
MMRRC Submission 043002-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.165) question?
Stock #R5437 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location50143299-50678646 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 50252602 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 449 (T449A)
Ref Sequence ENSEMBL: ENSMUSP00000147591 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]
Predicted Effect probably benign
Transcript: ENSMUST00000072685
AA Change: T449A

PolyPhen 2 Score 0.026 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531
AA Change: T449A

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111756
AA Change: T449A

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531
AA Change: T449A

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164039
AA Change: T449A

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531
AA Change: T449A

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
low complexity region 1129 1142 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000168357
AA Change: T26A
SMART Domains Protein: ENSMUSP00000129190
Gene: ENSMUSG00000043531
AA Change: T26A

DomainStartEndE-ValueType
VPS10 1 320 6.99e-58 SMART
PKD 322 412 3.84e-1 SMART
PKD 420 498 8.63e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209413
AA Change: T449A

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000209783
AA Change: T449A

PolyPhen 2 Score 0.027 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000211008
AA Change: T449A

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect probably benign
Transcript: ENSMUST00000211687
AA Change: T449A

PolyPhen 2 Score 0.190 (Sensitivity: 0.92; Specificity: 0.87)
Meta Mutation Damage Score 0.192 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency 97% (63/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca5 G A 11: 110,319,796 Q186* probably null Het
Acaca G A 11: 84,346,820 probably null Het
Acsm3 C A 7: 119,778,497 probably benign Het
Aoc1 C A 6: 48,907,750 Q576K probably benign Het
Atp6v0a4 T A 6: 38,076,733 N378I probably damaging Het
BC003331 T G 1: 150,363,518 I385L probably benign Het
Cacna1i A T 15: 80,371,529 H871L probably damaging Het
Clic4 C G 4: 135,217,246 R206P probably damaging Het
Commd9 G A 2: 101,901,028 G186D probably damaging Het
Cpne9 C T 6: 113,304,630 probably benign Het
Crhr2 C T 6: 55,100,733 V196I probably damaging Het
Dctn5 T A 7: 122,133,329 probably benign Het
Dhtkd1 C T 2: 5,924,119 R247Q probably benign Het
Dmrta1 G A 4: 89,691,756 G318R possibly damaging Het
Dpp6 T A 5: 27,663,501 Y487* probably null Het
Eef1akmt3 A T 10: 127,033,247 N119K probably damaging Het
Eloa A T 4: 136,012,885 L75Q probably damaging Het
Fat3 G A 9: 16,085,308 T1202M probably damaging Het
Fcho2 A G 13: 98,777,474 I205T possibly damaging Het
Fkbp10 A C 11: 100,421,023 D174A probably damaging Het
Gcnt2 T A 13: 40,861,176 F274L probably damaging Het
Gtf3c1 A T 7: 125,667,368 C969S probably damaging Het
Hook3 T C 8: 26,061,422 E130G probably benign Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Itsn1 T A 16: 91,818,591 probably benign Het
Kif13b C T 14: 64,806,114 R1788C probably damaging Het
Kif3a C T 11: 53,598,726 S135F probably damaging Het
Klf5 C T 14: 99,301,459 R23* probably null Het
Lcn5 A G 2: 25,658,011 I11V probably benign Het
Mpp7 A T 18: 7,458,930 probably null Het
Mroh5 T C 15: 73,787,969 I338V probably benign Het
Mthfd2l A G 5: 90,948,898 N126S possibly damaging Het
Myo18b G T 5: 112,757,573 A2053E possibly damaging Het
Naip6 A T 13: 100,303,304 C318* probably null Het
Ndufs7 C T 10: 80,254,924 R116C possibly damaging Het
Olfr1378 T C 11: 50,969,108 M30T probably benign Het
Pnkd T C 1: 74,349,737 V214A possibly damaging Het
Popdc2 T G 16: 38,362,901 V82G probably benign Het
Prkdc A T 16: 15,769,875 L2541F possibly damaging Het
Ptpn9 A T 9: 57,020,037 H66L possibly damaging Het
Pygm T A 19: 6,390,382 N397K probably damaging Het
Rabgap1l T A 1: 160,722,147 E324D probably damaging Het
Rnf6 G A 5: 146,210,280 R643C probably damaging Het
Ryr2 C T 13: 11,655,713 V3466M probably damaging Het
Scn7a A G 2: 66,676,346 Y1400H probably damaging Het
Sept10 T A 10: 59,176,959 N279I probably damaging Het
Sh3rf2 A T 18: 42,141,014 Y415F probably benign Het
Tcam1 C T 11: 106,285,423 T325M probably damaging Het
Tctn1 A G 5: 122,258,879 I147T probably benign Het
Tet1 G T 10: 62,814,451 H30Q probably benign Het
Tmem109 A G 19: 10,872,014 I159T probably damaging Het
Tmem40 C T 6: 115,759,031 probably benign Het
Tnfrsf21 C T 17: 43,037,862 P122S possibly damaging Het
Uaca A G 9: 60,871,451 D1038G probably benign Het
Ubr2 C G 17: 46,963,697 E852D probably benign Het
Ubr3 A T 2: 69,944,390 N518I probably damaging Het
Unc80 T G 1: 66,654,578 L2596R possibly damaging Het
Zcchc3 G A 2: 152,414,732 P16S probably benign Het
Other mutations in Sorcs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sorcs1 APN 19 50190054 missense probably damaging 1.00
IGL00983:Sorcs1 APN 19 50176128 missense probably damaging 0.98
IGL01125:Sorcs1 APN 19 50228201 missense probably damaging 1.00
IGL01320:Sorcs1 APN 19 50288079 splice site probably benign
IGL01445:Sorcs1 APN 19 50153066 missense probably damaging 1.00
IGL01682:Sorcs1 APN 19 50181506 missense probably benign 0.43
IGL01799:Sorcs1 APN 19 50230209 critical splice donor site probably null
IGL02044:Sorcs1 APN 19 50288159 splice site probably benign
IGL02111:Sorcs1 APN 19 50230245 missense probably benign 0.00
IGL02364:Sorcs1 APN 19 50333598 missense probably damaging 1.00
IGL02378:Sorcs1 APN 19 50182671 nonsense probably null
IGL02498:Sorcs1 APN 19 50678168 missense probably benign
IGL02658:Sorcs1 APN 19 50190092 missense probably damaging 1.00
IGL02939:Sorcs1 APN 19 50677930 nonsense probably null
IGL02942:Sorcs1 APN 19 50475437 missense probably damaging 1.00
IGL03057:Sorcs1 APN 19 50259756 nonsense probably null
IGL03230:Sorcs1 APN 19 50242093 missense probably damaging 1.00
P0033:Sorcs1 UTSW 19 50152907 missense probably damaging 0.98
R0109:Sorcs1 UTSW 19 50378891 splice site probably benign
R0115:Sorcs1 UTSW 19 50636453 intron probably benign
R0242:Sorcs1 UTSW 19 50228221 missense probably damaging 1.00
R0242:Sorcs1 UTSW 19 50228221 missense probably damaging 1.00
R0325:Sorcs1 UTSW 19 50313042 splice site probably null
R0481:Sorcs1 UTSW 19 50636453 intron probably benign
R0581:Sorcs1 UTSW 19 50252701 missense possibly damaging 0.70
R0669:Sorcs1 UTSW 19 50241942 splice site probably benign
R0980:Sorcs1 UTSW 19 50232323 missense probably benign 0.04
R1158:Sorcs1 UTSW 19 50144160 unclassified probably benign
R1519:Sorcs1 UTSW 19 50252587 missense probably benign 0.05
R1669:Sorcs1 UTSW 19 50475422 missense probably damaging 0.99
R1779:Sorcs1 UTSW 19 50175043 splice site probably benign
R1783:Sorcs1 UTSW 19 50228309 critical splice acceptor site probably null
R1927:Sorcs1 UTSW 19 50222195 missense probably damaging 1.00
R1935:Sorcs1 UTSW 19 50232644 missense probably damaging 0.96
R1936:Sorcs1 UTSW 19 50232644 missense probably damaging 0.96
R2109:Sorcs1 UTSW 19 50678192 missense probably benign
R2206:Sorcs1 UTSW 19 50230217 missense possibly damaging 0.81
R2207:Sorcs1 UTSW 19 50230217 missense possibly damaging 0.81
R3031:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3032:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3107:Sorcs1 UTSW 19 50210650 missense possibly damaging 0.83
R3508:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R3738:Sorcs1 UTSW 19 50151221 missense probably benign 0.03
R4127:Sorcs1 UTSW 19 50222159 missense probably benign 0.29
R4212:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R4213:Sorcs1 UTSW 19 50225175 missense probably damaging 0.98
R4385:Sorcs1 UTSW 19 50190161 missense probably benign 0.01
R4424:Sorcs1 UTSW 19 50378941 missense probably damaging 0.97
R4603:Sorcs1 UTSW 19 50312964 critical splice donor site probably null
R4679:Sorcs1 UTSW 19 50182669 missense probably benign
R4780:Sorcs1 UTSW 19 50143981 unclassified probably benign
R4781:Sorcs1 UTSW 19 50182681 missense probably damaging 1.00
R4823:Sorcs1 UTSW 19 50678140 missense possibly damaging 0.92
R4823:Sorcs1 UTSW 19 50230302 missense possibly damaging 0.87
R4883:Sorcs1 UTSW 19 50232303 missense probably benign 0.00
R5091:Sorcs1 UTSW 19 50259752 critical splice donor site probably null
R5105:Sorcs1 UTSW 19 50225141 missense possibly damaging 0.57
R5574:Sorcs1 UTSW 19 50222133 missense probably damaging 1.00
R5734:Sorcs1 UTSW 19 50182775 missense probably benign 0.04
R6045:Sorcs1 UTSW 19 50190117 nonsense probably null
R6091:Sorcs1 UTSW 19 50288101 missense possibly damaging 0.64
R6119:Sorcs1 UTSW 19 50288094 missense probably damaging 0.98
R6226:Sorcs1 UTSW 19 50181414 missense probably damaging 1.00
R6337:Sorcs1 UTSW 19 50144124 missense probably benign 0.00
R6378:Sorcs1 UTSW 19 50225177 missense possibly damaging 0.57
R6782:Sorcs1 UTSW 19 50176122 nonsense probably null
R6792:Sorcs1 UTSW 19 50678168 missense probably benign
R6891:Sorcs1 UTSW 19 50225119 nonsense probably null
R7151:Sorcs1 UTSW 19 50312982 missense probably damaging 1.00
R7223:Sorcs1 UTSW 19 50190042 missense probably benign 0.06
R7356:Sorcs1 UTSW 19 50175157 missense possibly damaging 0.86
X0024:Sorcs1 UTSW 19 50182763 missense possibly damaging 0.92
Z1088:Sorcs1 UTSW 19 50222143 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- CTAAAGTGAAGAGAGGCTGTCC -3'
(R):5'- GGAAGCATGCTCTATCTCTCC -3'

Sequencing Primer
(F):5'- GCTGTCCAAGGAACCAGCATTAG -3'
(R):5'- ACACGCTTTGGATGCATGC -3'
Posted On2016-09-01