Incidental Mutation 'R5438:Kcnn3'
ID428465
Institutional Source Beutler Lab
Gene Symbol Kcnn3
Ensembl Gene ENSMUSG00000000794
Gene Namepotassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Synonymssmall conductance calcium-activated potassium channel 3, SK3
MMRRC Submission 043003-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.445) question?
Stock #R5438 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location89520164-89675132 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 89521298 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Glutamine at position 277 (L277Q)
Ref Sequence ENSEMBL: ENSMUSP00000000811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000811]
Predicted Effect probably damaging
Transcript: ENSMUST00000000811
AA Change: L277Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000811
Gene: ENSMUSG00000000794
AA Change: L277Q

DomainStartEndE-ValueType
low complexity region 30 96 N/A INTRINSIC
low complexity region 139 154 N/A INTRINSIC
low complexity region 213 224 N/A INTRINSIC
Pfam:SK_channel 270 383 3.1e-51 PFAM
Pfam:Ion_trans_2 462 548 2.2e-14 PFAM
CaMBD 562 638 1.04e-49 SMART
low complexity region 684 690 N/A INTRINSIC
low complexity region 718 731 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for an insertion of a tetracycline-regulated gene switch display no overt phenotype when expression is abolished by doxycycline treatment; in contrast, untreated homozygotes show abnormal respiratory responses to hypoxia, impaired parturition, and pregnancy-related premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts17 C A 7: 66,888,417 Q244K probably benign Het
Arpc2 T A 1: 74,236,836 L4Q probably null Het
Atp7b C T 8: 22,014,554 V581I probably benign Het
Bpifb9b T A 2: 154,309,368 V3D possibly damaging Het
Capn13 A G 17: 73,326,484 F525L probably benign Het
Cmya5 G T 13: 93,095,199 T1127K possibly damaging Het
Col6a4 A T 9: 106,013,696 L1800I possibly damaging Het
Cpd T A 11: 76,791,966 I1076F possibly damaging Het
Elp4 A G 2: 105,904,403 F29S probably damaging Het
Exosc10 T A 4: 148,566,342 Y448* probably null Het
Fam219a A G 4: 41,520,302 S149P probably damaging Het
Gdap2 A T 3: 100,178,313 I184F probably damaging Het
Golgb1 A G 16: 36,900,508 N409D probably benign Het
Grin2b C T 6: 135,736,306 G859D probably damaging Het
Hvcn1 A G 5: 122,238,464 K153R probably damaging Het
Ighv3-1 T A 12: 113,964,469 H90L probably benign Het
Lama1 T A 17: 67,800,774 S2128T possibly damaging Het
Ltbp1 T A 17: 75,291,326 S919T probably damaging Het
Mgam A G 6: 40,684,521 N1163S probably damaging Het
Mypn G T 10: 63,135,839 C807* probably null Het
Olfr1031 T C 2: 85,992,581 F255L probably damaging Het
Olfr669 G A 7: 104,939,137 V204I probably benign Het
Otud7a A G 7: 63,757,459 N62S unknown Het
Pcdh18 A T 3: 49,756,016 Y283* probably null Het
Ptger2 A T 14: 44,989,644 H227L possibly damaging Het
Slc24a5 A G 2: 125,068,865 Y72C probably damaging Het
Slc35f2 T A 9: 53,801,018 D98E probably benign Het
Smad1 A T 8: 79,356,320 F184I probably benign Het
Sncg C T 14: 34,373,680 V52I probably benign Het
Tex33 T C 15: 78,378,840 T180A possibly damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Zc3h11a C T 1: 133,640,647 R88H probably damaging Het
Zfp141 A G 7: 42,489,470 V46A probably damaging Het
Zfp472 T A 17: 32,978,219 C423S probably damaging Het
Zfp729a A T 13: 67,619,586 H841Q possibly damaging Het
Other mutations in Kcnn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02263:Kcnn3 APN 3 89661218 missense possibly damaging 0.73
IGL02444:Kcnn3 APN 3 89652052 missense possibly damaging 0.50
IGL02500:Kcnn3 APN 3 89661112 splice site probably benign
IGL02814:Kcnn3 APN 3 89521175 missense possibly damaging 0.94
IGL02821:Kcnn3 APN 3 89662722 missense possibly damaging 0.84
IGL02821:Kcnn3 APN 3 89520974 missense possibly damaging 0.91
IGL02852:Kcnn3 APN 3 89609616 missense probably damaging 0.96
IGL02942:Kcnn3 APN 3 89652076 missense probably benign 0.00
IGL03118:Kcnn3 APN 3 89667161 missense probably damaging 1.00
R0015:Kcnn3 UTSW 3 89662773 missense probably damaging 1.00
R0015:Kcnn3 UTSW 3 89662773 missense probably damaging 1.00
R0032:Kcnn3 UTSW 3 89520665 small deletion probably benign
R0370:Kcnn3 UTSW 3 89667092 missense probably damaging 0.98
R0619:Kcnn3 UTSW 3 89652030 missense probably damaging 1.00
R1167:Kcnn3 UTSW 3 89564952 nonsense probably null
R1255:Kcnn3 UTSW 3 89652109 missense possibly damaging 0.84
R1643:Kcnn3 UTSW 3 89520497 missense unknown
R1733:Kcnn3 UTSW 3 89652090 missense probably benign 0.00
R1793:Kcnn3 UTSW 3 89609405 missense probably benign 0.20
R1827:Kcnn3 UTSW 3 89520994 missense possibly damaging 0.75
R1899:Kcnn3 UTSW 3 89520455 start gained probably benign
R2055:Kcnn3 UTSW 3 89521375 missense probably damaging 1.00
R2843:Kcnn3 UTSW 3 89520665 small deletion probably benign
R2922:Kcnn3 UTSW 3 89521022 missense probably damaging 1.00
R4078:Kcnn3 UTSW 3 89661188 missense possibly damaging 0.68
R4227:Kcnn3 UTSW 3 89521175 missense possibly damaging 0.94
R4604:Kcnn3 UTSW 3 89520420 start gained probably benign
R4814:Kcnn3 UTSW 3 89662724 missense probably damaging 1.00
R4822:Kcnn3 UTSW 3 89667289 missense possibly damaging 0.93
R5175:Kcnn3 UTSW 3 89609439 missense probably damaging 1.00
R5211:Kcnn3 UTSW 3 89521231 missense probably benign 0.04
R5496:Kcnn3 UTSW 3 89609490 missense possibly damaging 0.95
R6244:Kcnn3 UTSW 3 89645523 nonsense probably null
R7391:Kcnn3 UTSW 3 89609471 missense probably benign 0.34
Z1088:Kcnn3 UTSW 3 89667130 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTCTTCAGTCCCAGCAAC -3'
(R):5'- AAAGGAATTCTCACAGGACCATG -3'

Sequencing Primer
(F):5'- TTATCATCTCCTCCAGGGAG -3'
(R):5'- ACATGGGAAGTTAGGAAATCTCTC -3'
Posted On2016-09-01