Incidental Mutation 'R5439:Ralgapa2'
ID428504
Institutional Source Beutler Lab
Gene Symbol Ralgapa2
Ensembl Gene ENSMUSG00000037110
Gene NameRal GTPase activating protein, alpha subunit 2 (catalytic)
SynonymsAS250, RGC2, A230067G21Rik
MMRRC Submission 043004-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.318) question?
Stock #R5439 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location146239879-146512344 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 146342510 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 1526 (T1526A)
Ref Sequence ENSEMBL: ENSMUSP00000153734 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000109986] [ENSMUST00000131824] [ENSMUST00000228797]
Predicted Effect probably benign
Transcript: ENSMUST00000109986
AA Change: T1479A

PolyPhen 2 Score 0.049 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000105613
Gene: ENSMUSG00000037110
AA Change: T1479A

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 1017 1028 N/A INTRINSIC
low complexity region 1296 1301 N/A INTRINSIC
Pfam:Rap_GAP 1701 1877 6.8e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131824
AA Change: T1441A

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)
SMART Domains Protein: ENSMUSP00000122039
Gene: ENSMUSG00000037110
AA Change: T1441A

DomainStartEndE-ValueType
low complexity region 469 480 N/A INTRINSIC
low complexity region 979 990 N/A INTRINSIC
low complexity region 1258 1263 N/A INTRINSIC
Pfam:Rap_GAP 1663 1842 1.3e-66 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000146307
AA Change: T467A
SMART Domains Protein: ENSMUSP00000114547
Gene: ENSMUSG00000037110
AA Change: T467A

DomainStartEndE-ValueType
low complexity region 6 17 N/A INTRINSIC
low complexity region 285 290 N/A INTRINSIC
Pfam:Rap_GAP 690 830 4.9e-39 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000149499
AA Change: T1111A
SMART Domains Protein: ENSMUSP00000122017
Gene: ENSMUSG00000037110
AA Change: T1111A

DomainStartEndE-ValueType
low complexity region 140 151 N/A INTRINSIC
low complexity region 650 661 N/A INTRINSIC
low complexity region 929 934 N/A INTRINSIC
Pfam:Rap_GAP 1334 1511 2.4e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000228797
AA Change: T1526A

PolyPhen 2 Score 0.081 (Sensitivity: 0.93; Specificity: 0.85)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased incidence and severity of induced urothelial bladder tumors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 C A 4: 53,042,381 R1897L possibly damaging Het
Ablim2 A G 5: 35,857,826 K461E probably damaging Het
Acss3 A T 10: 106,937,147 Y659* probably null Het
Actr8 T G 14: 29,986,995 L253R probably damaging Het
Arid4b A G 13: 14,187,696 K915R probably damaging Het
C3 T C 17: 57,204,502 E1560G probably benign Het
Cacna1c A T 6: 118,654,372 I1013N probably damaging Het
Cep83 G A 10: 94,789,738 R670H probably benign Het
Col19a1 T A 1: 24,293,112 D870V probably damaging Het
Ddr2 A G 1: 170,004,729 V164A possibly damaging Het
Donson A T 16: 91,679,926 V549E probably damaging Het
Egflam C T 15: 7,224,663 G824R probably damaging Het
Extl3 A G 14: 65,054,626 F916S probably damaging Het
Fam110c A G 12: 31,074,407 M123V unknown Het
G3bp1 A T 11: 55,497,987 I342F probably damaging Het
Gm438 A T 4: 144,778,113 I156N probably damaging Het
Golgb1 A G 16: 36,900,508 N409D probably benign Het
Grin2b C T 6: 135,736,306 G859D probably damaging Het
Hspb1 A T 5: 135,889,332 T178S probably benign Het
Iigp1 A G 18: 60,390,257 Y149C probably damaging Het
Il22 G T 10: 118,209,461 G159* probably null Het
Jcad T C 18: 4,675,790 F1184S probably damaging Het
Kcnj2 G T 11: 111,072,231 V150L probably damaging Het
Kifc1 C T 17: 33,886,665 R56Q probably damaging Het
Lce1h A G 3: 92,763,720 S42P unknown Het
Lrp4 C A 2: 91,497,073 D1471E probably benign Het
Lrrc3 C A 10: 77,901,465 V46L probably benign Het
Mcf2l G A 8: 12,926,646 A2T possibly damaging Het
Med12l G A 3: 59,263,213 C1673Y probably null Het
Nckap1 T C 2: 80,512,690 E955G possibly damaging Het
Ndufs3 T A 2: 90,902,346 probably null Het
Nkx6-1 A G 5: 101,661,832 probably null Het
Obscn C A 11: 59,000,128 E1713* probably null Het
Olfr1335 G A 4: 118,809,363 T167I possibly damaging Het
Olfr134 T A 17: 38,176,026 probably null Het
Olfr148 A G 9: 39,613,620 T18A probably benign Het
Olfr1511 A G 14: 52,390,125 F216S probably damaging Het
Olfr429 A G 1: 174,089,975 R312G probably benign Het
Olfr58 A C 9: 19,783,865 H244P probably damaging Het
Olfr893 A G 9: 38,209,754 T234A probably benign Het
Osbpl5 A G 7: 143,741,696 F10L possibly damaging Het
Plvap A C 8: 71,511,451 I89S probably damaging Het
Ppp2r2a A G 14: 67,022,323 V308A possibly damaging Het
Ppp2r5e T C 12: 75,493,476 S132G probably benign Het
Pum3 G T 19: 27,412,259 Q398K probably benign Het
Sh3tc2 T A 18: 61,989,633 Y488* probably null Het
Spata48 A T 11: 11,490,244 R8S possibly damaging Het
Sqle A G 15: 59,330,904 Y537C probably benign Het
Sult2a8 T G 7: 14,425,514 K60T probably damaging Het
Tex15 T C 8: 33,574,171 S1210P possibly damaging Het
Thumpd3 A G 6: 113,066,864 silent Het
Timeless A G 10: 128,241,735 D228G probably damaging Het
Trim31 A T 17: 36,905,905 probably null Het
Ttc39c A T 18: 12,695,371 D196V possibly damaging Het
Wbp4 C A 14: 79,472,397 V133L possibly damaging Het
Wdr92 A G 11: 17,212,031 D23G possibly damaging Het
Zfp354c G T 11: 50,815,770 D159E probably benign Het
Zfp940 C A 7: 29,845,433 D350Y probably benign Het
Other mutations in Ralgapa2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00666:Ralgapa2 APN 2 146485136 missense possibly damaging 0.61
IGL00915:Ralgapa2 APN 2 146342522 missense probably damaging 1.00
IGL01012:Ralgapa2 APN 2 146421739 missense possibly damaging 0.95
IGL01018:Ralgapa2 APN 2 146410193 missense probably benign 0.02
IGL01018:Ralgapa2 APN 2 146410192 missense probably benign 0.00
IGL01902:Ralgapa2 APN 2 146315014 missense probably damaging 1.00
IGL02160:Ralgapa2 APN 2 146348440 splice site probably benign
IGL02321:Ralgapa2 APN 2 146412816 nonsense probably null
IGL02412:Ralgapa2 APN 2 146412132 missense probably damaging 0.96
IGL03026:Ralgapa2 APN 2 146460775 splice site probably benign
IGL03115:Ralgapa2 APN 2 146424814 missense probably damaging 0.99
IGL03256:Ralgapa2 APN 2 146460712 critical splice donor site probably null
IGL03379:Ralgapa2 APN 2 146357987 missense probably benign 0.01
P4748:Ralgapa2 UTSW 2 146346811 nonsense probably null
R0012:Ralgapa2 UTSW 2 146412752 missense probably benign
R0012:Ralgapa2 UTSW 2 146412752 missense probably benign
R0165:Ralgapa2 UTSW 2 146388487 splice site probably benign
R0344:Ralgapa2 UTSW 2 146346794 missense possibly damaging 0.69
R0402:Ralgapa2 UTSW 2 146434809 missense probably damaging 0.98
R0419:Ralgapa2 UTSW 2 146428672 missense possibly damaging 0.69
R0638:Ralgapa2 UTSW 2 146342192 missense probably benign 0.00
R0704:Ralgapa2 UTSW 2 146451784 missense probably damaging 1.00
R0722:Ralgapa2 UTSW 2 146388531 missense probably damaging 1.00
R0866:Ralgapa2 UTSW 2 146436003 missense probably damaging 1.00
R1065:Ralgapa2 UTSW 2 146450558 missense probably benign 0.00
R1212:Ralgapa2 UTSW 2 146357982 missense probably benign 0.00
R1395:Ralgapa2 UTSW 2 146388500 missense probably damaging 1.00
R1614:Ralgapa2 UTSW 2 146388612 missense probably damaging 1.00
R1686:Ralgapa2 UTSW 2 146358000 missense probably benign 0.09
R1799:Ralgapa2 UTSW 2 146342728 missense probably benign 0.02
R1905:Ralgapa2 UTSW 2 146387701 missense probably damaging 1.00
R1956:Ralgapa2 UTSW 2 146460759 missense probably benign 0.00
R2144:Ralgapa2 UTSW 2 146388604 missense probably damaging 1.00
R2148:Ralgapa2 UTSW 2 146431887 missense probably benign 0.02
R2219:Ralgapa2 UTSW 2 146421679 missense probably benign 0.09
R2220:Ralgapa2 UTSW 2 146421679 missense probably benign 0.09
R2261:Ralgapa2 UTSW 2 146342683 missense probably damaging 1.00
R2402:Ralgapa2 UTSW 2 146353192 missense probably damaging 1.00
R2495:Ralgapa2 UTSW 2 146361400 missense possibly damaging 0.82
R3752:Ralgapa2 UTSW 2 146421631 missense possibly damaging 0.94
R3953:Ralgapa2 UTSW 2 146435964 missense probably damaging 1.00
R3956:Ralgapa2 UTSW 2 146435964 missense probably damaging 1.00
R4177:Ralgapa2 UTSW 2 146485163 missense probably damaging 1.00
R4182:Ralgapa2 UTSW 2 146435994 missense probably damaging 1.00
R4193:Ralgapa2 UTSW 2 146342573 missense probably damaging 1.00
R4332:Ralgapa2 UTSW 2 146260368 missense probably benign 0.10
R4507:Ralgapa2 UTSW 2 146353248 missense probably benign 0.11
R4574:Ralgapa2 UTSW 2 146435999 missense probably damaging 1.00
R4585:Ralgapa2 UTSW 2 146315024 missense probably damaging 0.99
R4627:Ralgapa2 UTSW 2 146361453 missense possibly damaging 0.88
R4647:Ralgapa2 UTSW 2 146387629 missense possibly damaging 0.69
R4677:Ralgapa2 UTSW 2 146345467 missense possibly damaging 0.82
R4724:Ralgapa2 UTSW 2 146345533 missense possibly damaging 0.46
R4760:Ralgapa2 UTSW 2 146346749 missense probably benign 0.00
R4831:Ralgapa2 UTSW 2 146405067 intron probably benign
R4962:Ralgapa2 UTSW 2 146434834 nonsense probably null
R4993:Ralgapa2 UTSW 2 146447311 missense probably damaging 1.00
R5041:Ralgapa2 UTSW 2 146485151 missense probably benign 0.00
R5120:Ralgapa2 UTSW 2 146412084 missense probably benign 0.26
R5185:Ralgapa2 UTSW 2 146388486 splice site probably null
R5393:Ralgapa2 UTSW 2 146345455 missense probably damaging 1.00
R5428:Ralgapa2 UTSW 2 146334494 missense probably damaging 0.96
R5476:Ralgapa2 UTSW 2 146447436 missense probably benign
R5695:Ralgapa2 UTSW 2 146333477 missense probably damaging 1.00
R5705:Ralgapa2 UTSW 2 146449273 missense probably damaging 1.00
R5718:Ralgapa2 UTSW 2 146453406 splice site probably null
R5817:Ralgapa2 UTSW 2 146333486 missense probably damaging 1.00
R5877:Ralgapa2 UTSW 2 146388569 missense probably damaging 1.00
R5994:Ralgapa2 UTSW 2 146361453 missense probably benign 0.00
R6048:Ralgapa2 UTSW 2 146434845 missense possibly damaging 0.46
R6158:Ralgapa2 UTSW 2 146424676 missense possibly damaging 0.69
R6169:Ralgapa2 UTSW 2 146450465 missense probably damaging 1.00
R6280:Ralgapa2 UTSW 2 146342209 missense probably damaging 1.00
R6301:Ralgapa2 UTSW 2 146327411 missense possibly damaging 0.94
R6650:Ralgapa2 UTSW 2 146388502 missense probably damaging 1.00
R6959:Ralgapa2 UTSW 2 146342701 missense probably damaging 0.98
R7020:Ralgapa2 UTSW 2 146346718 nonsense probably null
R7035:Ralgapa2 UTSW 2 146511857 missense probably damaging 1.00
X0019:Ralgapa2 UTSW 2 146388652 missense possibly damaging 0.56
Z1088:Ralgapa2 UTSW 2 146434905 missense probably benign 0.20
Predicted Primers PCR Primer
(F):5'- AATCTTTCTGAGGTCCACATGTG -3'
(R):5'- AATGGTCATGGCCCACCTAG -3'

Sequencing Primer
(F):5'- ACATGTGTGATGATGCCAGCC -3'
(R):5'- GTCATGGCCCACCTAGTGAAC -3'
Posted On2016-09-01