Incidental Mutation 'R5439:Olfr1335'
ID428508
Institutional Source Beutler Lab
Gene Symbol Olfr1335
Ensembl Gene ENSMUSG00000066061
Gene Nameolfactory receptor 1335
SynonymsGA_x6K02T2QD9B-18723799-18724749, GA_x6K02T2QD9B-18726774-18727577, MOR259-12, MOR259-5, Olfr1334-ps1, Olfr1335
MMRRC Submission 043004-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.107) question?
Stock #R5439 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location118808797-118809944 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 118809363 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 167 (T167I)
Ref Sequence ENSEMBL: ENSMUSP00000151219 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000084313] [ENSMUST00000105035] [ENSMUST00000219094]
Predicted Effect possibly damaging
Transcript: ENSMUST00000084313
AA Change: T151I

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000081339
Gene: ENSMUSG00000066061
AA Change: T151I

DomainStartEndE-ValueType
Pfam:7tm_4 50 326 2.3e-56 PFAM
Pfam:7TM_GPCR_Srsx 54 323 3.7e-8 PFAM
Pfam:7tm_1 60 309 2.1e-26 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000105035
AA Change: T151I

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000100652
Gene: ENSMUSG00000073768
AA Change: T151I

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 38 307 6.4e-8 PFAM
Pfam:7tm_1 44 293 2.9e-31 PFAM
Pfam:7tm_4 142 286 6.7e-46 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000219094
AA Change: T167I

PolyPhen 2 Score 0.951 (Sensitivity: 0.79; Specificity: 0.95)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 C A 4: 53,042,381 R1897L possibly damaging Het
Ablim2 A G 5: 35,857,826 K461E probably damaging Het
Acss3 A T 10: 106,937,147 Y659* probably null Het
Actr8 T G 14: 29,986,995 L253R probably damaging Het
Arid4b A G 13: 14,187,696 K915R probably damaging Het
C3 T C 17: 57,204,502 E1560G probably benign Het
Cacna1c A T 6: 118,654,372 I1013N probably damaging Het
Cep83 G A 10: 94,789,738 R670H probably benign Het
Col19a1 T A 1: 24,293,112 D870V probably damaging Het
Ddr2 A G 1: 170,004,729 V164A possibly damaging Het
Donson A T 16: 91,679,926 V549E probably damaging Het
Egflam C T 15: 7,224,663 G824R probably damaging Het
Extl3 A G 14: 65,054,626 F916S probably damaging Het
Fam110c A G 12: 31,074,407 M123V unknown Het
G3bp1 A T 11: 55,497,987 I342F probably damaging Het
Gm438 A T 4: 144,778,113 I156N probably damaging Het
Golgb1 A G 16: 36,900,508 N409D probably benign Het
Grin2b C T 6: 135,736,306 G859D probably damaging Het
Hspb1 A T 5: 135,889,332 T178S probably benign Het
Iigp1 A G 18: 60,390,257 Y149C probably damaging Het
Il22 G T 10: 118,209,461 G159* probably null Het
Jcad T C 18: 4,675,790 F1184S probably damaging Het
Kcnj2 G T 11: 111,072,231 V150L probably damaging Het
Kifc1 C T 17: 33,886,665 R56Q probably damaging Het
Lce1h A G 3: 92,763,720 S42P unknown Het
Lrp4 C A 2: 91,497,073 D1471E probably benign Het
Lrrc3 C A 10: 77,901,465 V46L probably benign Het
Mcf2l G A 8: 12,926,646 A2T possibly damaging Het
Med12l G A 3: 59,263,213 C1673Y probably null Het
Nckap1 T C 2: 80,512,690 E955G possibly damaging Het
Ndufs3 T A 2: 90,902,346 probably null Het
Nkx6-1 A G 5: 101,661,832 probably null Het
Obscn C A 11: 59,000,128 E1713* probably null Het
Olfr134 T A 17: 38,176,026 probably null Het
Olfr148 A G 9: 39,613,620 T18A probably benign Het
Olfr1511 A G 14: 52,390,125 F216S probably damaging Het
Olfr429 A G 1: 174,089,975 R312G probably benign Het
Olfr58 A C 9: 19,783,865 H244P probably damaging Het
Olfr893 A G 9: 38,209,754 T234A probably benign Het
Osbpl5 A G 7: 143,741,696 F10L possibly damaging Het
Plvap A C 8: 71,511,451 I89S probably damaging Het
Ppp2r2a A G 14: 67,022,323 V308A possibly damaging Het
Ppp2r5e T C 12: 75,493,476 S132G probably benign Het
Pum3 G T 19: 27,412,259 Q398K probably benign Het
Ralgapa2 T C 2: 146,342,510 T1526A probably benign Het
Sh3tc2 T A 18: 61,989,633 Y488* probably null Het
Spata48 A T 11: 11,490,244 R8S possibly damaging Het
Sqle A G 15: 59,330,904 Y537C probably benign Het
Sult2a8 T G 7: 14,425,514 K60T probably damaging Het
Tex15 T C 8: 33,574,171 S1210P possibly damaging Het
Thumpd3 A G 6: 113,066,864 silent Het
Timeless A G 10: 128,241,735 D228G probably damaging Het
Trim31 A T 17: 36,905,905 probably null Het
Ttc39c A T 18: 12,695,371 D196V possibly damaging Het
Wbp4 C A 14: 79,472,397 V133L possibly damaging Het
Wdr92 A G 11: 17,212,031 D23G possibly damaging Het
Zfp354c G T 11: 50,815,770 D159E probably benign Het
Zfp940 C A 7: 29,845,433 D350Y probably benign Het
Other mutations in Olfr1335
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01096:Olfr1335 APN 4 118809456 missense probably damaging 0.98
IGL02481:Olfr1335 APN 4 118809499 missense probably benign 0.01
IGL02483:Olfr1335 APN 4 118809499 missense probably benign 0.01
R0058:Olfr1335 UTSW 4 118809480 missense probably benign
R0069:Olfr1335 UTSW 4 118809690 missense probably damaging 1.00
R0357:Olfr1335 UTSW 4 118809417 missense probably damaging 1.00
R1274:Olfr1335 UTSW 4 118809396 missense probably benign 0.01
R1432:Olfr1335 UTSW 4 118809238 missense probably benign 0.00
R2305:Olfr1335 UTSW 4 118808861 missense probably benign 0.35
R2368:Olfr1335 UTSW 4 118809822 missense probably benign
R3842:Olfr1335 UTSW 4 118809255 missense probably damaging 1.00
R3980:Olfr1335 UTSW 4 118809303 missense probably benign 0.22
R4722:Olfr1335 UTSW 4 118808949 missense probably damaging 0.99
R5074:Olfr1335 UTSW 4 118808860 missense possibly damaging 0.82
R5930:Olfr1335 UTSW 4 118809378 missense probably benign 0.01
R6917:Olfr1335 UTSW 4 118809129 missense probably damaging 1.00
X0023:Olfr1335 UTSW 4 118809621 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCCCTGGGTGGACTTAATCTTG -3'
(R):5'- AGACCATCTCCTTTGCTAGCTG -3'

Sequencing Primer
(F):5'- AATCTTGAGAATTGCCTTGGC -3'
(R):5'- GCTGGCTGCAGATGTACG -3'
Posted On2016-09-01