Incidental Mutation 'R5439:Grin2b'
ID428514
Institutional Source Beutler Lab
Gene Symbol Grin2b
Ensembl Gene ENSMUSG00000030209
Gene Nameglutamate receptor, ionotropic, NMDA2B (epsilon 2)
SynonymsGluRepsilon2, NMDAR2B, GluN2B, Nmdar2b, NR2B
MMRRC Submission 043004-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5439 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location135713233-136173511 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 135736306 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 859 (G859D)
Ref Sequence ENSEMBL: ENSMUSP00000107536 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053880] [ENSMUST00000111905]
Predicted Effect probably damaging
Transcript: ENSMUST00000053880
AA Change: G859D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000062284
Gene: ENSMUSG00000030209
AA Change: G859D

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 106 306 8.6e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 4.8e-270 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000111905
AA Change: G859D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107536
Gene: ENSMUSG00000030209
AA Change: G859D

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:ANF_receptor 56 307 4.2e-10 PFAM
PBPe 431 799 1.06e-67 SMART
Lig_chan-Glu_bd 440 503 1.82e-22 SMART
Pfam:NMDAR2_C 840 1482 2.1e-245 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136027
Predicted Effect noncoding transcript
Transcript: ENSMUST00000158638
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] N-methyl-D-aspartate (NMDA) receptors are a class of ionotropic glutamate receptors. NMDA receptor channel has been shown to be involved in long-term potentiation, an activity-dependent increase in the efficiency of synaptic transmission thought to underlie certain kinds of memory and learning. NMDA receptor channels are heteromers composed of three different subunits: NR1 (GRIN1), NR2 (GRIN2A, GRIN2B, GRIN2C, or GRIN2D) and NR3 (GRIN3A or GRIN3B). The NR2 subunit acts as the agonist binding site for glutamate. This receptor is the predominant excitatory neurotransmitter receptor in the mammalian brain. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit impairments in suckling, in hippocampal long term depression, and in pattern formation of trigeminal nucleus sensory afferent terminals. Mutants die shortly after birth. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 C A 4: 53,042,381 R1897L possibly damaging Het
Ablim2 A G 5: 35,857,826 K461E probably damaging Het
Acss3 A T 10: 106,937,147 Y659* probably null Het
Actr8 T G 14: 29,986,995 L253R probably damaging Het
Arid4b A G 13: 14,187,696 K915R probably damaging Het
C3 T C 17: 57,204,502 E1560G probably benign Het
Cacna1c A T 6: 118,654,372 I1013N probably damaging Het
Cep83 G A 10: 94,789,738 R670H probably benign Het
Col19a1 T A 1: 24,293,112 D870V probably damaging Het
Ddr2 A G 1: 170,004,729 V164A possibly damaging Het
Donson A T 16: 91,679,926 V549E probably damaging Het
Egflam C T 15: 7,224,663 G824R probably damaging Het
Extl3 A G 14: 65,054,626 F916S probably damaging Het
Fam110c A G 12: 31,074,407 M123V unknown Het
G3bp1 A T 11: 55,497,987 I342F probably damaging Het
Gm438 A T 4: 144,778,113 I156N probably damaging Het
Golgb1 A G 16: 36,900,508 N409D probably benign Het
Hspb1 A T 5: 135,889,332 T178S probably benign Het
Iigp1 A G 18: 60,390,257 Y149C probably damaging Het
Il22 G T 10: 118,209,461 G159* probably null Het
Jcad T C 18: 4,675,790 F1184S probably damaging Het
Kcnj2 G T 11: 111,072,231 V150L probably damaging Het
Kifc1 C T 17: 33,886,665 R56Q probably damaging Het
Lce1h A G 3: 92,763,720 S42P unknown Het
Lrp4 C A 2: 91,497,073 D1471E probably benign Het
Lrrc3 C A 10: 77,901,465 V46L probably benign Het
Mcf2l G A 8: 12,926,646 A2T possibly damaging Het
Med12l G A 3: 59,263,213 C1673Y probably null Het
Nckap1 T C 2: 80,512,690 E955G possibly damaging Het
Ndufs3 T A 2: 90,902,346 probably null Het
Nkx6-1 A G 5: 101,661,832 probably null Het
Obscn C A 11: 59,000,128 E1713* probably null Het
Olfr1335 G A 4: 118,809,363 T167I possibly damaging Het
Olfr134 T A 17: 38,176,026 probably null Het
Olfr148 A G 9: 39,613,620 T18A probably benign Het
Olfr1511 A G 14: 52,390,125 F216S probably damaging Het
Olfr429 A G 1: 174,089,975 R312G probably benign Het
Olfr58 A C 9: 19,783,865 H244P probably damaging Het
Olfr893 A G 9: 38,209,754 T234A probably benign Het
Osbpl5 A G 7: 143,741,696 F10L possibly damaging Het
Plvap A C 8: 71,511,451 I89S probably damaging Het
Ppp2r2a A G 14: 67,022,323 V308A possibly damaging Het
Ppp2r5e T C 12: 75,493,476 S132G probably benign Het
Pum3 G T 19: 27,412,259 Q398K probably benign Het
Ralgapa2 T C 2: 146,342,510 T1526A probably benign Het
Sh3tc2 T A 18: 61,989,633 Y488* probably null Het
Spata48 A T 11: 11,490,244 R8S possibly damaging Het
Sqle A G 15: 59,330,904 Y537C probably benign Het
Sult2a8 T G 7: 14,425,514 K60T probably damaging Het
Tex15 T C 8: 33,574,171 S1210P possibly damaging Het
Thumpd3 A G 6: 113,066,864 silent Het
Timeless A G 10: 128,241,735 D228G probably damaging Het
Trim31 A T 17: 36,905,905 probably null Het
Ttc39c A T 18: 12,695,371 D196V possibly damaging Het
Wbp4 C A 14: 79,472,397 V133L possibly damaging Het
Wdr92 A G 11: 17,212,031 D23G possibly damaging Het
Zfp354c G T 11: 50,815,770 D159E probably benign Het
Zfp940 C A 7: 29,845,433 D350Y probably benign Het
Other mutations in Grin2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00494:Grin2b APN 6 135736331 missense possibly damaging 0.55
IGL00835:Grin2b APN 6 135733570 missense probably damaging 1.00
IGL01401:Grin2b APN 6 135736363 missense probably damaging 1.00
IGL01523:Grin2b APN 6 136044265 missense probably null 0.99
IGL01719:Grin2b APN 6 135733381 missense probably damaging 0.97
IGL01907:Grin2b APN 6 135733740 missense probably damaging 1.00
IGL01996:Grin2b APN 6 135732586 missense probably damaging 1.00
IGL02309:Grin2b APN 6 135736472 missense probably damaging 1.00
IGL02312:Grin2b APN 6 135739090 missense probably damaging 1.00
IGL02409:Grin2b APN 6 136043908 missense possibly damaging 0.89
IGL02527:Grin2b APN 6 135923391 missense probably damaging 1.00
IGL02535:Grin2b APN 6 135779369 missense possibly damaging 0.70
IGL02570:Grin2b APN 6 135922998 missense probably damaging 1.00
IGL02702:Grin2b APN 6 135739132 missense probably damaging 0.99
IGL03001:Grin2b APN 6 135739115 missense probably damaging 1.00
IGL03274:Grin2b APN 6 135780255 missense possibly damaging 0.90
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0055:Grin2b UTSW 6 135923203 missense probably benign
R0164:Grin2b UTSW 6 135778648 splice site probably benign
R0194:Grin2b UTSW 6 135779305 missense probably damaging 1.00
R0594:Grin2b UTSW 6 135733929 missense probably damaging 1.00
R1434:Grin2b UTSW 6 135843195 missense probably benign 0.04
R1928:Grin2b UTSW 6 136044046 missense probably damaging 1.00
R1942:Grin2b UTSW 6 135732732 missense possibly damaging 0.93
R1996:Grin2b UTSW 6 136044211 missense possibly damaging 0.52
R2002:Grin2b UTSW 6 135733245 missense probably damaging 1.00
R2020:Grin2b UTSW 6 135733896 missense probably benign 0.12
R2103:Grin2b UTSW 6 135780140 missense probably benign 0.02
R2127:Grin2b UTSW 6 135778700 missense probably benign 0.03
R2495:Grin2b UTSW 6 135733182 missense probably damaging 1.00
R2656:Grin2b UTSW 6 135733429 missense probably damaging 1.00
R2847:Grin2b UTSW 6 135740953 missense probably damaging 1.00
R2866:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R2867:Grin2b UTSW 6 135733639 missense probably damaging 1.00
R3196:Grin2b UTSW 6 135732455 small deletion probably benign
R3418:Grin2b UTSW 6 135843110 missense probably benign 0.02
R3808:Grin2b UTSW 6 135923271 missense probably damaging 0.99
R4028:Grin2b UTSW 6 135736435 missense probably damaging 1.00
R4602:Grin2b UTSW 6 135778741 missense probably damaging 1.00
R4624:Grin2b UTSW 6 135733825 missense probably damaging 0.99
R4677:Grin2b UTSW 6 135774872 missense probably benign 0.13
R4744:Grin2b UTSW 6 135778699 missense probably damaging 1.00
R5020:Grin2b UTSW 6 135733407 missense probably benign 0.01
R5051:Grin2b UTSW 6 135779395 missense possibly damaging 0.84
R5105:Grin2b UTSW 6 135732441 missense probably benign 0.03
R5125:Grin2b UTSW 6 135923299 missense possibly damaging 0.89
R5146:Grin2b UTSW 6 135779342 missense probably damaging 1.00
R5318:Grin2b UTSW 6 135733918 missense probably damaging 0.99
R5349:Grin2b UTSW 6 136044283 missense possibly damaging 0.93
R5426:Grin2b UTSW 6 135732368 missense probably damaging 1.00
R5438:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5440:Grin2b UTSW 6 135736306 missense probably damaging 1.00
R5530:Grin2b UTSW 6 135733723 missense probably benign 0.00
R5603:Grin2b UTSW 6 135923397 missense probably damaging 1.00
R5657:Grin2b UTSW 6 135733087 missense possibly damaging 0.48
R5788:Grin2b UTSW 6 135740964 missense probably benign 0.24
R5941:Grin2b UTSW 6 135736373 missense probably damaging 0.99
R6057:Grin2b UTSW 6 135733944 missense possibly damaging 0.84
R6137:Grin2b UTSW 6 135923458 missense possibly damaging 0.89
R6216:Grin2b UTSW 6 135772399 missense probably damaging 1.00
R6309:Grin2b UTSW 6 135733027 missense probably benign 0.00
R6316:Grin2b UTSW 6 135780279 missense probably benign 0.00
R6419:Grin2b UTSW 6 135740967 missense probably damaging 1.00
R6551:Grin2b UTSW 6 135733344 missense probably damaging 1.00
R6612:Grin2b UTSW 6 135740998 missense probably damaging 1.00
R6616:Grin2b UTSW 6 135732551 missense probably benign
R6647:Grin2b UTSW 6 135733110 missense probably damaging 1.00
R6806:Grin2b UTSW 6 135774828 missense possibly damaging 0.84
R6976:Grin2b UTSW 6 135780200 missense probably benign
R7033:Grin2b UTSW 6 135923038 missense probably damaging 1.00
R7058:Grin2b UTSW 6 135780306 missense probably damaging 0.97
R7144:Grin2b UTSW 6 135733476 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- TTCTCTCACACAGACCCTTGGG -3'
(R):5'- TCCTCGTTCTAGGGGAGATG -3'

Sequencing Primer
(F):5'- GGAAGTGCCCGTGATCTG -3'
(R):5'- AAGAACTGGAAGCTCTCTGGCTC -3'
Posted On2016-09-01