Incidental Mutation 'R5439:Zfp940'
ID428516
Institutional Source Beutler Lab
Gene Symbol Zfp940
Ensembl Gene ENSMUSG00000050855
Gene Namezinc finger protein 940
SynonymsBC027344
MMRRC Submission 043004-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.376) question?
Stock #R5439 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location29833620-29853669 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 29845433 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Tyrosine at position 350 (D350Y)
Ref Sequence ENSEMBL: ENSMUSP00000082947 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085792] [ENSMUST00000108223]
Predicted Effect probably benign
Transcript: ENSMUST00000085792
AA Change: D350Y

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000082947
Gene: ENSMUSG00000050855
AA Change: D350Y

DomainStartEndE-ValueType
KRAB 6 66 1.05e-31 SMART
ZnF_C2H2 251 273 3.69e-4 SMART
ZnF_C2H2 279 301 5.5e-3 SMART
ZnF_C2H2 307 329 7.67e-2 SMART
ZnF_C2H2 340 362 2.71e-2 SMART
ZnF_C2H2 368 390 5.34e-1 SMART
ZnF_C2H2 396 418 1.38e-3 SMART
ZnF_C2H2 424 446 3.39e-3 SMART
ZnF_C2H2 452 474 6.78e-3 SMART
ZnF_C2H2 485 507 4.79e-3 SMART
ZnF_C2H2 513 535 2.24e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000108223
SMART Domains Protein: ENSMUSP00000103858
Gene: ENSMUSG00000050855

DomainStartEndE-ValueType
KRAB 6 67 2.42e-22 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145098
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca1 C A 4: 53,042,381 R1897L possibly damaging Het
Ablim2 A G 5: 35,857,826 K461E probably damaging Het
Acss3 A T 10: 106,937,147 Y659* probably null Het
Actr8 T G 14: 29,986,995 L253R probably damaging Het
Arid4b A G 13: 14,187,696 K915R probably damaging Het
C3 T C 17: 57,204,502 E1560G probably benign Het
Cacna1c A T 6: 118,654,372 I1013N probably damaging Het
Cep83 G A 10: 94,789,738 R670H probably benign Het
Col19a1 T A 1: 24,293,112 D870V probably damaging Het
Ddr2 A G 1: 170,004,729 V164A possibly damaging Het
Donson A T 16: 91,679,926 V549E probably damaging Het
Egflam C T 15: 7,224,663 G824R probably damaging Het
Extl3 A G 14: 65,054,626 F916S probably damaging Het
Fam110c A G 12: 31,074,407 M123V unknown Het
G3bp1 A T 11: 55,497,987 I342F probably damaging Het
Gm438 A T 4: 144,778,113 I156N probably damaging Het
Golgb1 A G 16: 36,900,508 N409D probably benign Het
Grin2b C T 6: 135,736,306 G859D probably damaging Het
Hspb1 A T 5: 135,889,332 T178S probably benign Het
Iigp1 A G 18: 60,390,257 Y149C probably damaging Het
Il22 G T 10: 118,209,461 G159* probably null Het
Jcad T C 18: 4,675,790 F1184S probably damaging Het
Kcnj2 G T 11: 111,072,231 V150L probably damaging Het
Kifc1 C T 17: 33,886,665 R56Q probably damaging Het
Lce1h A G 3: 92,763,720 S42P unknown Het
Lrp4 C A 2: 91,497,073 D1471E probably benign Het
Lrrc3 C A 10: 77,901,465 V46L probably benign Het
Mcf2l G A 8: 12,926,646 A2T possibly damaging Het
Med12l G A 3: 59,263,213 C1673Y probably null Het
Nckap1 T C 2: 80,512,690 E955G possibly damaging Het
Ndufs3 T A 2: 90,902,346 probably null Het
Nkx6-1 A G 5: 101,661,832 probably null Het
Obscn C A 11: 59,000,128 E1713* probably null Het
Olfr1335 G A 4: 118,809,363 T167I possibly damaging Het
Olfr134 T A 17: 38,176,026 probably null Het
Olfr148 A G 9: 39,613,620 T18A probably benign Het
Olfr1511 A G 14: 52,390,125 F216S probably damaging Het
Olfr429 A G 1: 174,089,975 R312G probably benign Het
Olfr58 A C 9: 19,783,865 H244P probably damaging Het
Olfr893 A G 9: 38,209,754 T234A probably benign Het
Osbpl5 A G 7: 143,741,696 F10L possibly damaging Het
Plvap A C 8: 71,511,451 I89S probably damaging Het
Ppp2r2a A G 14: 67,022,323 V308A possibly damaging Het
Ppp2r5e T C 12: 75,493,476 S132G probably benign Het
Pum3 G T 19: 27,412,259 Q398K probably benign Het
Ralgapa2 T C 2: 146,342,510 T1526A probably benign Het
Sh3tc2 T A 18: 61,989,633 Y488* probably null Het
Spata48 A T 11: 11,490,244 R8S possibly damaging Het
Sqle A G 15: 59,330,904 Y537C probably benign Het
Sult2a8 T G 7: 14,425,514 K60T probably damaging Het
Tex15 T C 8: 33,574,171 S1210P possibly damaging Het
Thumpd3 A G 6: 113,066,864 silent Het
Timeless A G 10: 128,241,735 D228G probably damaging Het
Trim31 A T 17: 36,905,905 probably null Het
Ttc39c A T 18: 12,695,371 D196V possibly damaging Het
Wbp4 C A 14: 79,472,397 V133L possibly damaging Het
Wdr92 A G 11: 17,212,031 D23G possibly damaging Het
Zfp354c G T 11: 50,815,770 D159E probably benign Het
Other mutations in Zfp940
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01941:Zfp940 APN 7 29846870 missense probably damaging 1.00
IGL02092:Zfp940 APN 7 29846201 missense probably benign
IGL02498:Zfp940 APN 7 29846951 missense probably damaging 0.97
R0503:Zfp940 UTSW 7 29846020 intron probably benign
R0614:Zfp940 UTSW 7 29846246 missense probably benign 0.03
R1604:Zfp940 UTSW 7 29846075 missense probably benign
R1619:Zfp940 UTSW 7 29845537 missense possibly damaging 0.85
R1715:Zfp940 UTSW 7 29844938 missense probably damaging 0.96
R1749:Zfp940 UTSW 7 29845527 nonsense probably null
R1862:Zfp940 UTSW 7 29845010 missense probably damaging 1.00
R4017:Zfp940 UTSW 7 29845934 missense probably benign
R4673:Zfp940 UTSW 7 29845438 missense probably benign 0.00
R4761:Zfp940 UTSW 7 29846153 missense probably benign 0.12
R4890:Zfp940 UTSW 7 29845399 missense probably benign 0.01
R5027:Zfp940 UTSW 7 29850956 utr 5 prime probably benign
R5285:Zfp940 UTSW 7 29845600 missense probably damaging 0.99
R5340:Zfp940 UTSW 7 29844841 missense probably benign 0.33
R5983:Zfp940 UTSW 7 29845052 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- AGCTTTTCCACAGACTCCACAG -3'
(R):5'- CTGTAAGGAGTGCGGAAAGTCC -3'

Sequencing Primer
(F):5'- GATGTCGCATCAAGTTTGACC -3'
(R):5'- TCGCAGAATTCACACCGGTG -3'
Posted On2016-09-01