Incidental Mutation 'R5440:Myo5c'
ID428589
Institutional Source Beutler Lab
Gene Symbol Myo5c
Ensembl Gene ENSMUSG00000033590
Gene Namemyosin VC
Synonyms9130003O20Rik
MMRRC Submission 043005-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.146) question?
Stock #R5440 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location75232020-75305451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 75258125 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 405 (I405N)
Ref Sequence ENSEMBL: ENSMUSP00000042229 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036555] [ENSMUST00000216788]
Predicted Effect possibly damaging
Transcript: ENSMUST00000036555
AA Change: I405N

PolyPhen 2 Score 0.912 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000042229
Gene: ENSMUSG00000033590
AA Change: I405N

DomainStartEndE-ValueType
MYSc 61 754 N/A SMART
IQ 755 777 1.11e-3 SMART
IQ 778 800 1.39e0 SMART
IQ 806 828 8.98e-4 SMART
IQ 829 851 4.19e-4 SMART
IQ 854 876 2.54e-3 SMART
coiled coil region 1160 1185 N/A INTRINSIC
coiled coil region 1207 1245 N/A INTRINSIC
DIL 1574 1679 5.54e-45 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000215352
Predicted Effect probably benign
Transcript: ENSMUST00000216788
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Apc G T 18: 34,221,160 probably benign Het
Apol11b T A 15: 77,635,593 K96* probably null Het
Arhgap35 C T 7: 16,562,924 G739S probably damaging Het
Atp6v0a4 A C 6: 38,092,817 F47V probably damaging Het
Bcl9 G A 3: 97,210,565 P271L probably benign Het
Cd109 T C 9: 78,680,164 probably null Het
Col12a1 T A 9: 79,614,363 I2771F probably benign Het
Col6a1 A G 10: 76,723,454 V116A probably damaging Het
Cpsf2 C G 12: 101,996,879 L401V probably benign Het
Cwf19l2 G A 9: 3,475,549 E829K probably damaging Het
D7Ertd443e G A 7: 134,349,275 T223I probably damaging Het
Dtx4 G A 19: 12,492,317 R149C probably damaging Het
Fam186b C T 15: 99,273,853 A838T possibly damaging Het
Fzd4 G T 7: 89,408,118 E458* probably null Het
Gm17669 C T 18: 67,562,456 P24S possibly damaging Het
Grin2b C T 6: 135,736,306 G859D probably damaging Het
Gucy2e T C 11: 69,223,646 Y1019C probably damaging Het
Gzme T A 14: 56,118,453 N134I possibly damaging Het
Havcr1 A T 11: 46,752,370 Y39F probably damaging Het
Hint3 A T 10: 30,618,351 M1K probably null Het
Hspa4l A G 3: 40,781,576 K543R probably damaging Het
Ifna9 A G 4: 88,591,811 probably null Het
Itgb4 C T 11: 115,984,157 R447W probably benign Het
Lipo2 A G 19: 33,720,858 I373T probably benign Het
Olfr517 T C 7: 108,868,626 H176R probably damaging Het
P2rx1 A G 11: 73,008,503 M108V probably benign Het
Pcsk2 T A 2: 143,546,543 V18E probably benign Het
Pigr A T 1: 130,849,622 probably null Het
Pkp1 A T 1: 135,882,492 C447S probably benign Het
Prom1 T A 5: 44,058,646 I96F probably benign Het
Prpf4b T C 13: 34,884,093 probably benign Het
Ropn1 C A 16: 34,671,172 D102E probably benign Het
Slc35e2 C T 4: 155,610,026 P10L probably benign Het
Sphk1 T G 11: 116,534,888 V17G possibly damaging Het
Syngr1 A G 15: 80,098,018 N2S probably benign Het
Syt9 T G 7: 107,502,123 S359A possibly damaging Het
Terb1 T C 8: 104,488,499 I282V probably damaging Het
Ttn T A 2: 76,754,824 I22042F probably damaging Het
Ttn A T 2: 76,909,256 D3646E probably benign Het
Ube2d1 A G 10: 71,255,852 W141R probably damaging Het
Vmn2r41 T A 7: 8,138,363 I701F probably damaging Het
Zfp770 T C 2: 114,196,115 D491G probably benign Het
Other mutations in Myo5c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00093:Myo5c APN 9 75242880 splice site probably benign
IGL00848:Myo5c APN 9 75289181 missense probably benign
IGL01503:Myo5c APN 9 75263042 missense probably damaging 1.00
IGL01735:Myo5c APN 9 75301438 missense probably damaging 1.00
IGL01866:Myo5c APN 9 75269582 missense probably benign 0.00
IGL01956:Myo5c APN 9 75242876 splice site probably null
IGL02127:Myo5c APN 9 75300902 missense probably damaging 1.00
IGL02268:Myo5c APN 9 75246237 missense probably damaging 1.00
IGL02272:Myo5c APN 9 75266160 missense possibly damaging 0.73
IGL03052:Myo5c APN 9 75252516 splice site probably benign
IGL03179:Myo5c APN 9 75255866 missense possibly damaging 0.65
IGL03224:Myo5c APN 9 75278243 missense probably benign 0.01
PIT4142001:Myo5c UTSW 9 75283948 missense probably benign 0.00
R0126:Myo5c UTSW 9 75269525 missense probably benign 0.05
R0266:Myo5c UTSW 9 75284216 splice site probably benign
R0345:Myo5c UTSW 9 75297419 missense probably damaging 1.00
R0387:Myo5c UTSW 9 75285021 splice site probably benign
R0602:Myo5c UTSW 9 75266196 splice site probably null
R0675:Myo5c UTSW 9 75278289 missense probably benign
R0798:Myo5c UTSW 9 75257984 missense probably damaging 1.00
R0981:Myo5c UTSW 9 75271591 missense probably damaging 1.00
R1051:Myo5c UTSW 9 75290883 missense probably benign 0.00
R1072:Myo5c UTSW 9 75292208 missense probably damaging 1.00
R1144:Myo5c UTSW 9 75286448 missense probably damaging 1.00
R1454:Myo5c UTSW 9 75263066 missense possibly damaging 0.94
R1476:Myo5c UTSW 9 75275939 missense probably damaging 1.00
R1484:Myo5c UTSW 9 75300810 missense probably damaging 1.00
R1586:Myo5c UTSW 9 75267031 missense probably damaging 0.99
R1616:Myo5c UTSW 9 75296017 missense probably damaging 1.00
R1635:Myo5c UTSW 9 75277075 missense probably benign 0.09
R1800:Myo5c UTSW 9 75246164 missense probably damaging 1.00
R1838:Myo5c UTSW 9 75273553 missense probably damaging 1.00
R1840:Myo5c UTSW 9 75249735 missense probably damaging 1.00
R1885:Myo5c UTSW 9 75249761 missense probably damaging 1.00
R1897:Myo5c UTSW 9 75292241 missense probably benign 0.20
R1898:Myo5c UTSW 9 75297626 missense probably damaging 1.00
R2029:Myo5c UTSW 9 75289055 unclassified probably benign
R2063:Myo5c UTSW 9 75281868 missense probably benign 0.19
R2230:Myo5c UTSW 9 75273606 missense probably benign
R2519:Myo5c UTSW 9 75250436 missense probably damaging 1.00
R2520:Myo5c UTSW 9 75297649 nonsense probably null
R3034:Myo5c UTSW 9 75286577 missense probably benign 0.44
R3117:Myo5c UTSW 9 75266194 critical splice donor site probably null
R3432:Myo5c UTSW 9 75263001 missense probably damaging 1.00
R3751:Myo5c UTSW 9 75276002 missense probably damaging 1.00
R4132:Myo5c UTSW 9 75252568 missense probably benign 0.00
R4173:Myo5c UTSW 9 75246258 missense probably damaging 1.00
R4239:Myo5c UTSW 9 75283942 missense probably benign 0.01
R4429:Myo5c UTSW 9 75294001 missense probably damaging 1.00
R4574:Myo5c UTSW 9 75269611 missense probably benign 0.00
R4791:Myo5c UTSW 9 75290916 missense probably damaging 1.00
R4804:Myo5c UTSW 9 75245024 missense probably damaging 1.00
R4819:Myo5c UTSW 9 75292202 missense probably damaging 0.97
R4881:Myo5c UTSW 9 75284152 missense probably benign 0.00
R4900:Myo5c UTSW 9 75273543 missense probably damaging 1.00
R4964:Myo5c UTSW 9 75297509 missense possibly damaging 0.51
R4966:Myo5c UTSW 9 75269596 missense probably benign 0.03
R5057:Myo5c UTSW 9 75300873 missense probably damaging 1.00
R5347:Myo5c UTSW 9 75295205 missense probably null 1.00
R5399:Myo5c UTSW 9 75288074 missense possibly damaging 0.80
R5569:Myo5c UTSW 9 75273510 missense probably damaging 1.00
R5600:Myo5c UTSW 9 75289154 missense probably benign 0.00
R5606:Myo5c UTSW 9 75275508 missense probably damaging 1.00
R5704:Myo5c UTSW 9 75272903 missense probably benign 0.00
R5798:Myo5c UTSW 9 75284198 missense probably benign 0.04
R5865:Myo5c UTSW 9 75297488 missense probably damaging 0.97
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6034:Myo5c UTSW 9 75255905 missense probably benign 0.05
R6143:Myo5c UTSW 9 75249809 missense probably damaging 1.00
R6242:Myo5c UTSW 9 75273611 missense probably benign
R6253:Myo5c UTSW 9 75245037 missense probably damaging 1.00
R6264:Myo5c UTSW 9 75275554 missense probably benign
R6307:Myo5c UTSW 9 75272916 missense possibly damaging 0.73
R6358:Myo5c UTSW 9 75296012 missense possibly damaging 0.53
R6450:Myo5c UTSW 9 75286578 missense probably benign 0.26
R6598:Myo5c UTSW 9 75246234 missense probably damaging 1.00
R6618:Myo5c UTSW 9 75275637 critical splice donor site probably null
R6774:Myo5c UTSW 9 75289186 missense probably benign 0.05
R6865:Myo5c UTSW 9 75269596 missense probably benign 0.03
Z1088:Myo5c UTSW 9 75245059 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTTGGATGCCTGATGGG -3'
(R):5'- TCTTCAAAACAAGCAAGACAAGTGG -3'

Sequencing Primer
(F):5'- GTTTGTTTCTTGAAGGAGGATGACAG -3'
(R):5'- TGGAAGGGTGCAACTTAAAAACAAC -3'
Posted On2016-09-01