Incidental Mutation 'R5404:Clec4b2'
ID428623
Institutional Source Beutler Lab
Gene Symbol Clec4b2
Ensembl Gene ENSMUSG00000067767
Gene NameC-type lectin domain family 4, member b2
SynonymsF830043G12Rik, mDCAR1
MMRRC Submission 042975-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.051) question?
Stock #R5404 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location123172893-123204671 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 123181349 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 58 (Y58F)
Ref Sequence ENSEMBL: ENSMUSP00000085802 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088455]
Predicted Effect probably benign
Transcript: ENSMUST00000088455
AA Change: Y58F

PolyPhen 2 Score 0.063 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000085802
Gene: ENSMUSG00000067767
AA Change: Y58F

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
CLECT 79 202 1.87e-33 SMART
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.6%
  • 20x: 96.0%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A1bg T C 15: 60,919,696 H297R probably benign Het
Ccnk A T 12: 108,195,623 K262N possibly damaging Het
Cp A C 3: 19,989,128 T1027P possibly damaging Het
Cpox G A 16: 58,675,286 G322D probably damaging Het
Cry1 T C 10: 85,184,419 N18S probably damaging Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Dock10 A G 1: 80,503,913 probably benign Het
Fance A T 17: 28,318,060 R58W probably null Het
Fermt1 T C 2: 132,934,869 D233G possibly damaging Het
Gabpa T A 16: 84,860,463 Y409N probably damaging Het
Gpr162 A G 6: 124,861,643 S15P possibly damaging Het
Grid2 T A 6: 63,930,910 I178N probably damaging Het
Il17re T C 6: 113,469,102 V233A probably benign Het
Lemd3 G A 10: 120,931,958 Q672* probably null Het
Myh15 A G 16: 49,159,978 T1488A probably benign Het
Narf T A 11: 121,242,626 H84Q probably benign Het
Nedd1 C T 10: 92,716,192 V69I probably benign Het
Nfil3 G A 13: 52,968,055 S271F probably damaging Het
Npc1 A G 18: 12,213,299 L280P possibly damaging Het
Olfr1181 C T 2: 88,423,801 V75M probably damaging Het
Olfr138 T A 17: 38,275,626 L285* probably null Het
Olfr559 T A 7: 102,723,600 I297F possibly damaging Het
Poli A G 18: 70,509,432 S503P probably benign Het
Rbm5 T C 9: 107,765,553 E94G probably damaging Het
Robo4 CGG CG 9: 37,411,490 probably null Het
Rps6ka5 T C 12: 100,616,093 I173M probably damaging Het
Slc40a1 A G 1: 45,912,328 L223P probably damaging Het
Smg1 T C 7: 118,206,908 K213E probably damaging Het
Spem1 T A 11: 69,820,937 K300N probably damaging Het
Tchh A G 3: 93,447,675 E1474G unknown Het
Tenm4 A T 7: 96,894,680 R1968W probably damaging Het
Tshz2 A T 2: 169,884,320 M279L probably benign Het
Tuba3a G T 6: 125,281,592 T145K possibly damaging Het
Other mutations in Clec4b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00956:Clec4b2 APN 6 123202151 nonsense probably null
IGL01753:Clec4b2 APN 6 123202210 missense possibly damaging 0.90
IGL02168:Clec4b2 APN 6 123204197 missense probably damaging 0.98
IGL02388:Clec4b2 APN 6 123202228 splice site probably null
IGL03194:Clec4b2 APN 6 123200987 missense probably benign 0.07
P0041:Clec4b2 UTSW 6 123181294 missense possibly damaging 0.72
R0013:Clec4b2 UTSW 6 123202149 missense probably damaging 1.00
R0121:Clec4b2 UTSW 6 123204172 missense probably benign 0.02
R0401:Clec4b2 UTSW 6 123181300 nonsense probably null
R1072:Clec4b2 UTSW 6 123204274 missense probably damaging 0.99
R2520:Clec4b2 UTSW 6 123200983 missense probably damaging 1.00
R4575:Clec4b2 UTSW 6 123173680 missense probably damaging 0.99
R4897:Clec4b2 UTSW 6 123201040 nonsense probably null
R4898:Clec4b2 UTSW 6 123204204 missense probably benign 0.36
R5022:Clec4b2 UTSW 6 123200956 missense probably null 1.00
R5023:Clec4b2 UTSW 6 123200956 missense probably null 1.00
R5057:Clec4b2 UTSW 6 123200956 missense probably null 1.00
R5508:Clec4b2 UTSW 6 123173042 start gained probably benign
R6082:Clec4b2 UTSW 6 123204141 critical splice acceptor site probably null
R6333:Clec4b2 UTSW 6 123200678 unclassified probably null
R6902:Clec4b2 UTSW 6 123201028 nonsense probably null
R6946:Clec4b2 UTSW 6 123201028 nonsense probably null
R7144:Clec4b2 UTSW 6 123181384 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- TGCCATGTTGGACTTAAGTGG -3'
(R):5'- GCTTAGGCAGAGAACTTCTCCT -3'

Sequencing Primer
(F):5'- CCATGTTGGACTTAAGTGGGGTAG -3'
(R):5'- CTTGAACTAAATGCCTGGACACTGG -3'
Posted On2016-09-06