Mutagenetix > Incidental Mutation

Incidental Mutation 'R5405:Chd6'

428658

Institutional Source

Beutler Lab

Gene Symbol

Chd6

Ensembl Gene

ENSMUSG00000057133

Gene Name

chromodomain helicase DNA binding protein 6

Synonyms

5430439G14Rik, 6330406J24Rik

Accession Numbers

Essential gene?

Probably essential (E-score: 0.755) question?

Stock #

R5405 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

160788898-160950995 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 160807310 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Arginine to Lysine at position 1968 (R1968K)

Ref Sequence

ENSEMBL: ENSMUSP00000042291 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000039782]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000039782
AA Change: R1968K

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000042291
Gene: ENSMUSG00000057133
AA Change: R1968K

Domain	Start	End	E-Value	Type
low complexity region	86	106	N/A	INTRINSIC
low complexity region	113	143	N/A	INTRINSIC
low complexity region	214	229	N/A	INTRINSIC
CHROMO	289	355	1.35e-4	SMART
CHROMO	372	430	3.48e-7	SMART
DEXDc	456	658	1.73e-39	SMART
HELICc	812	896	3.84e-23	SMART
low complexity region	1080	1094	N/A	INTRINSIC
Blast:DEXDc	1108	1153	4e-23	BLAST
SANT	1445	1504	1.51e0	SMART
low complexity region	1866	1875	N/A	INTRINSIC
low complexity region	2048	2057	N/A	INTRINSIC
low complexity region	2130	2140	N/A	INTRINSIC
low complexity region	2277	2290	N/A	INTRINSIC
low complexity region	2333	2349	N/A	INTRINSIC
low complexity region	2437	2446	N/A	INTRINSIC
low complexity region	2539	2563	N/A	INTRINSIC
low complexity region	2652	2659	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000137152

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000143081

Coding Region Coverage

1x: 99.3%
3x: 98.5%
10x: 96.8%
20x: 94.1%

Validation Efficiency

MGI Phenotype

FUNCTION: This gene encodes a member of the chromodomain/helicase/DNA-binding domain family of chromatin remodeling enzymes. This protein has been found to be specifically involved in transcription initiation and elongation. Homozygous knockout mice exhibit impaired motor coordination. A pseudogene has been identified on chromosome 8. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous null mice display impaired coordination that is not due to muscle weakness or bradykinesia. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 43 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Add2	A	T	6: 86,078,179 (GRCm39)	T298S	probably benign	Het
Atad2b	G	A	12: 4,990,098 (GRCm39)	R141Q	possibly damaging	Het
B3glct	A	G	5: 149,632,818 (GRCm39)	Q56R	probably damaging	Het
Cdc42bpa	A	G	1: 179,894,894 (GRCm39)	Y358C	probably damaging	Het
Cdc42bpa	A	G	1: 179,966,085 (GRCm39)	E1136G	possibly damaging	Het
Ceacam1	A	T	7: 25,163,290 (GRCm39)	N314K	probably benign	Het
Ces1g	A	T	8: 94,032,496 (GRCm39)	I488N	probably benign	Het
Cyp27b1	C	T	10: 126,886,255 (GRCm39)	T312I	possibly damaging	Het
Cyp39a1	C	T	17: 43,987,831 (GRCm39)	A99V	probably damaging	Het
Dipk1a	C	T	5: 108,057,827 (GRCm39)	V199I	probably benign	Het
Dnaaf9	A	G	2: 130,554,380 (GRCm39)	S890P	probably damaging	Het
Efcab3	A	T	11: 104,612,018 (GRCm39)	D620V	probably benign	Het
Elapor1	A	T	3: 108,375,102 (GRCm39)	C588*	probably null	Het
Erc1	A	T	6: 119,801,905 (GRCm39)	S37R	probably damaging	Het
Gm10801	TC	TCGAC	2: 98,494,151 (GRCm39)		probably benign	Het
Gm14443	T	C	2: 175,013,644 (GRCm39)	I43V	possibly damaging	Het
Ins2	C	T	7: 142,233,134 (GRCm39)	R46H	probably damaging	Het
Krt77	T	C	15: 101,769,523 (GRCm39)	I413V	probably damaging	Het
Lpin3	A	G	2: 160,745,849 (GRCm39)	D660G	probably damaging	Het
Mpp3	T	C	11: 101,901,047 (GRCm39)	Q318R	probably benign	Het
Mpzl2	T	C	9: 44,958,503 (GRCm39)	S80P	probably damaging	Het
Mrpl2	T	C	17: 46,960,036 (GRCm39)		probably null	Het
Mrpl48	T	C	7: 100,209,000 (GRCm39)	Y108C	probably damaging	Het
Ndufaf7	C	A	17: 79,246,044 (GRCm39)	F92L	probably damaging	Het
Or14c43	T	C	7: 86,115,383 (GRCm39)	Y255H	probably damaging	Het
Or6c8	T	A	10: 128,915,265 (GRCm39)	D189V	probably damaging	Het
Rec114	T	C	9: 58,567,624 (GRCm39)	S121G	probably benign	Het
Rnase10	A	T	14: 51,247,317 (GRCm39)	I195F	probably damaging	Het
Rnd2	C	T	11: 101,359,825 (GRCm39)	L57F	probably damaging	Het
Rreb1	A	G	13: 38,133,087 (GRCm39)	E1754G	probably damaging	Het
Sec31a	G	T	5: 100,531,657 (GRCm39)	C238*	probably null	Het
Slc12a6	T	C	2: 112,169,724 (GRCm39)	V337A	probably damaging	Het
Slc25a37	A	G	14: 69,482,344 (GRCm39)	V319A	possibly damaging	Het
Slc26a10	T	C	10: 127,010,864 (GRCm39)	Y456C	probably benign	Het
Slc27a3	G	A	3: 90,294,382 (GRCm39)	T463I	probably benign	Het
Slc66a3	A	G	12: 17,043,315 (GRCm39)		probably benign	Het
Stard9	T	A	2: 120,524,149 (GRCm39)	D781E	probably benign	Het
Tle1	T	C	4: 72,057,208 (GRCm39)		probably benign	Het
Tmem229b-ps	T	C	10: 53,351,325 (GRCm39)		noncoding transcript	Het
Vmn2r114	ATTT	ATT	17: 23,509,906 (GRCm39)		probably null	Het
Vmn2r71	A	G	7: 85,268,622 (GRCm39)	D275G	probably benign	Het
Wdr1	T	C	5: 38,692,543 (GRCm39)	T121A	probably benign	Het
Zdhhc19	C	T	16: 32,325,869 (GRCm39)	R240C	possibly damaging	Het

Other mutations in Chd6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00837:Chd6	APN	2	160,883,999 (GRCm39)	missense	probably benign	0.01
IGL00899:Chd6	APN	2	160,871,218 (GRCm39)	splice site	probably benign
IGL01104:Chd6	APN	2	160,803,847 (GRCm39)	missense	probably damaging	1.00
IGL01295:Chd6	APN	2	160,830,290 (GRCm39)	splice site	probably benign
IGL01717:Chd6	APN	2	160,807,179 (GRCm39)	missense	possibly damaging	0.96
IGL01795:Chd6	APN	2	160,803,294 (GRCm39)	missense	probably benign	0.00
IGL01814:Chd6	APN	2	160,901,849 (GRCm39)	missense	probably benign	0.25
IGL02016:Chd6	APN	2	160,825,598 (GRCm39)	missense	probably damaging	1.00
IGL02104:Chd6	APN	2	160,819,432 (GRCm39)	missense	probably benign
IGL02158:Chd6	APN	2	160,868,212 (GRCm39)	missense	possibly damaging	0.73
IGL02313:Chd6	APN	2	160,807,595 (GRCm39)	missense	probably damaging	1.00
IGL02472:Chd6	APN	2	160,826,372 (GRCm39)	splice site	probably benign
IGL02522:Chd6	APN	2	160,807,716 (GRCm39)	missense	probably benign	0.30
IGL02626:Chd6	APN	2	160,881,270 (GRCm39)	splice site	probably benign
IGL02727:Chd6	APN	2	160,811,383 (GRCm39)	missense	probably damaging	0.96
IGL02738:Chd6	APN	2	160,807,618 (GRCm39)	missense	probably benign	0.45
IGL02743:Chd6	APN	2	160,802,183 (GRCm39)	missense	probably damaging	1.00
IGL02800:Chd6	APN	2	160,826,552 (GRCm39)	missense	probably damaging	1.00
IGL02811:Chd6	APN	2	160,832,221 (GRCm39)	missense	probably damaging	1.00
IGL02850:Chd6	APN	2	160,861,536 (GRCm39)	nonsense	probably null
IGL02979:Chd6	APN	2	160,808,090 (GRCm39)	missense	possibly damaging	0.48
IGL02993:Chd6	APN	2	160,894,304 (GRCm39)	splice site	probably benign
IGL03277:Chd6	APN	2	160,824,981 (GRCm39)	missense	probably null	1.00
IGL03346:Chd6	APN	2	160,802,282 (GRCm39)	missense	probably benign	0.00
IGL03357:Chd6	APN	2	160,859,936 (GRCm39)	splice site	probably benign
IGL03134:Chd6	UTSW	2	160,807,403 (GRCm39)	missense	possibly damaging	0.88
R0106:Chd6	UTSW	2	160,809,822 (GRCm39)	missense	probably damaging	1.00
R0106:Chd6	UTSW	2	160,809,822 (GRCm39)	missense	probably damaging	1.00
R0212:Chd6	UTSW	2	160,894,767 (GRCm39)	missense	probably damaging	0.99
R0363:Chd6	UTSW	2	160,856,244 (GRCm39)	missense	probably damaging	1.00
R0399:Chd6	UTSW	2	160,894,608 (GRCm39)	missense	probably damaging	1.00
R0511:Chd6	UTSW	2	160,834,111 (GRCm39)	missense	probably damaging	0.99
R0771:Chd6	UTSW	2	160,861,500 (GRCm39)	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160,832,191 (GRCm39)	missense	probably damaging	1.00
R1147:Chd6	UTSW	2	160,832,191 (GRCm39)	missense	probably damaging	1.00
R1184:Chd6	UTSW	2	160,872,722 (GRCm39)	missense	probably damaging	1.00
R1277:Chd6	UTSW	2	160,809,735 (GRCm39)	missense	probably damaging	1.00
R1396:Chd6	UTSW	2	160,825,023 (GRCm39)	missense	probably damaging	1.00
R1647:Chd6	UTSW	2	160,883,978 (GRCm39)	missense	probably damaging	1.00
R1648:Chd6	UTSW	2	160,883,978 (GRCm39)	missense	probably damaging	1.00
R1745:Chd6	UTSW	2	160,823,587 (GRCm39)	missense	probably damaging	0.96
R1766:Chd6	UTSW	2	160,808,559 (GRCm39)	missense	probably damaging	1.00
R1871:Chd6	UTSW	2	160,832,176 (GRCm39)	missense	probably damaging	1.00
R1928:Chd6	UTSW	2	160,809,920 (GRCm39)	splice site	probably benign
R1973:Chd6	UTSW	2	160,808,307 (GRCm39)	missense	probably damaging	0.99
R2200:Chd6	UTSW	2	160,825,673 (GRCm39)	missense	probably damaging	1.00
R2340:Chd6	UTSW	2	160,807,679 (GRCm39)	frame shift	probably null
R2341:Chd6	UTSW	2	160,807,679 (GRCm39)	frame shift	probably null
R2519:Chd6	UTSW	2	160,871,796 (GRCm39)	missense	possibly damaging	0.66
R2919:Chd6	UTSW	2	160,809,800 (GRCm39)	missense	possibly damaging	0.89
R3025:Chd6	UTSW	2	160,808,472 (GRCm39)	small deletion	probably benign
R3426:Chd6	UTSW	2	160,832,175 (GRCm39)	missense	probably damaging	1.00
R3427:Chd6	UTSW	2	160,832,175 (GRCm39)	missense	probably damaging	1.00
R4042:Chd6	UTSW	2	160,830,253 (GRCm39)	missense	probably damaging	1.00
R4273:Chd6	UTSW	2	160,803,211 (GRCm39)	missense	probably benign	0.04
R4360:Chd6	UTSW	2	160,791,776 (GRCm39)	missense	possibly damaging	0.48
R4399:Chd6	UTSW	2	160,807,238 (GRCm39)	missense	probably benign
R4458:Chd6	UTSW	2	160,871,796 (GRCm39)	missense	possibly damaging	0.66
R4583:Chd6	UTSW	2	160,856,114 (GRCm39)	missense	probably damaging	1.00
R4625:Chd6	UTSW	2	160,811,412 (GRCm39)	missense	probably damaging	1.00
R4740:Chd6	UTSW	2	160,812,103 (GRCm39)	missense	probably benign
R4765:Chd6	UTSW	2	160,808,164 (GRCm39)	nonsense	probably null
R4779:Chd6	UTSW	2	160,791,477 (GRCm39)	missense	probably damaging	1.00
R4877:Chd6	UTSW	2	160,871,219 (GRCm39)	splice site	probably benign
R5068:Chd6	UTSW	2	160,808,289 (GRCm39)	missense	possibly damaging	0.54
R5215:Chd6	UTSW	2	160,791,873 (GRCm39)	missense	probably damaging	1.00
R5275:Chd6	UTSW	2	160,811,283 (GRCm39)	missense	probably benign
R5598:Chd6	UTSW	2	160,856,032 (GRCm39)	missense	probably damaging	1.00
R5693:Chd6	UTSW	2	160,807,185 (GRCm39)	missense	probably benign
R5697:Chd6	UTSW	2	160,859,971 (GRCm39)	missense	probably damaging	1.00
R5715:Chd6	UTSW	2	160,791,798 (GRCm39)	missense	probably benign	0.00
R5759:Chd6	UTSW	2	160,825,682 (GRCm39)	missense	possibly damaging	0.91
R5761:Chd6	UTSW	2	160,798,999 (GRCm39)	missense	probably damaging	1.00
R5761:Chd6	UTSW	2	160,798,998 (GRCm39)	missense	probably damaging	1.00
R5954:Chd6	UTSW	2	160,807,747 (GRCm39)	missense	probably benign	0.00
R6025:Chd6	UTSW	2	160,807,502 (GRCm39)	missense	probably benign
R6104:Chd6	UTSW	2	160,856,052 (GRCm39)	missense	probably damaging	1.00
R6247:Chd6	UTSW	2	160,791,968 (GRCm39)	missense	probably damaging	1.00
R6393:Chd6	UTSW	2	160,821,407 (GRCm39)	missense	probably damaging	1.00
R6452:Chd6	UTSW	2	160,807,418 (GRCm39)	missense	possibly damaging	0.76
R6468:Chd6	UTSW	2	160,854,987 (GRCm39)	missense	probably damaging	1.00
R6784:Chd6	UTSW	2	160,808,174 (GRCm39)	missense	probably damaging	1.00
R6803:Chd6	UTSW	2	160,802,279 (GRCm39)	missense	possibly damaging	0.64
R6869:Chd6	UTSW	2	160,807,650 (GRCm39)	missense	probably benign
R6895:Chd6	UTSW	2	160,830,260 (GRCm39)	missense	probably damaging	1.00
R6925:Chd6	UTSW	2	160,855,047 (GRCm39)	missense	probably damaging	0.98
R7061:Chd6	UTSW	2	160,867,885 (GRCm39)	nonsense	probably null
R7064:Chd6	UTSW	2	160,791,983 (GRCm39)	missense	probably damaging	1.00
R7248:Chd6	UTSW	2	160,803,199 (GRCm39)	nonsense	probably null
R7287:Chd6	UTSW	2	160,850,312 (GRCm39)	missense	probably benign	0.07
R7431:Chd6	UTSW	2	160,868,248 (GRCm39)	missense	possibly damaging	0.92
R7486:Chd6	UTSW	2	160,791,923 (GRCm39)	missense	probably damaging	1.00
R7509:Chd6	UTSW	2	160,855,074 (GRCm39)	missense	probably damaging	1.00
R7699:Chd6	UTSW	2	160,867,863 (GRCm39)	missense	probably benign	0.13
R7748:Chd6	UTSW	2	160,808,539 (GRCm39)	missense	probably benign	0.37
R7785:Chd6	UTSW	2	160,812,095 (GRCm39)	missense	possibly damaging	0.51
R8002:Chd6	UTSW	2	160,832,241 (GRCm39)	missense	probably damaging	1.00
R8261:Chd6	UTSW	2	160,799,002 (GRCm39)	missense	probably damaging	1.00
R8317:Chd6	UTSW	2	160,832,241 (GRCm39)	missense	probably damaging	1.00
R8388:Chd6	UTSW	2	160,861,571 (GRCm39)	missense	probably damaging	1.00
R8865:Chd6	UTSW	2	160,862,989 (GRCm39)	missense	probably benign	0.10
R8867:Chd6	UTSW	2	160,862,989 (GRCm39)	missense	probably benign	0.10
R8996:Chd6	UTSW	2	160,823,543 (GRCm39)	missense	probably damaging	1.00
R9091:Chd6	UTSW	2	160,871,793 (GRCm39)	nonsense	probably null
R9270:Chd6	UTSW	2	160,871,793 (GRCm39)	nonsense	probably null
R9310:Chd6	UTSW	2	160,881,181 (GRCm39)	missense	probably damaging	1.00
R9367:Chd6	UTSW	2	160,871,784 (GRCm39)	missense	possibly damaging	0.83
R9438:Chd6	UTSW	2	160,799,078 (GRCm39)	missense	probably benign	0.01
R9756:Chd6	UTSW	2	160,802,259 (GRCm39)	missense	probably benign
Z1088:Chd6	UTSW	2	160,808,408 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TGAGGCAGGTTCCATCTTTCTC -3'
(R):5'- GCTTCCACCAAGATGAAGCC -3'

Sequencing Primer
(F):5'- AGGCAGGTTCCATCTTTCTCATAATC -3'
(R):5'- TTCCACCAAGATGAAGCCAAGAAAG -3'

Posted On

2016-09-06