Incidental Mutation 'R5371:Olfr156'
ID428706
Institutional Source Beutler Lab
Gene Symbol Olfr156
Ensembl Gene ENSMUSG00000110970
Gene Nameolfactory receptor 156
SynonymsGA_x6K02T2N78B-16125144-16126100, OR37B, Olfr37b, mOR37b, MOR262-6
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.134) question?
Stock #R5371 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location43820132-43823895 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 43821058 bp
ZygosityHeterozygous
Amino Acid Change Methionine to Lysine at position 101 (M101K)
Ref Sequence ENSEMBL: ENSMUSP00000148995 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079234] [ENSMUST00000079465] [ENSMUST00000214843] [ENSMUST00000215406]
Predicted Effect probably damaging
Transcript: ENSMUST00000079234
AA Change: M101K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078226
Gene: ENSMUSG00000110970
AA Change: M101K

DomainStartEndE-ValueType
Pfam:7tm_4 31 314 4.8e-58 PFAM
Pfam:7tm_1 41 296 2.9e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000079465
AA Change: M101K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078431
Gene: ENSMUSG00000110970
AA Change: M101K

DomainStartEndE-ValueType
Pfam:7tm_4 31 314 1.2e-58 PFAM
Pfam:7tm_1 41 296 6.5e-25 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000214843
AA Change: M101K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000215406
AA Change: M101K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.0324 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 96% (71/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik G T 7: 29,562,493 noncoding transcript Het
Arpp21 G A 9: 112,065,932 P755S probably benign Het
Aspm C T 1: 139,470,541 Q982* probably null Het
Atp5e C T 2: 174,462,526 probably benign Het
BC024139 A G 15: 76,120,686 *598Q probably null Het
Bcl6 T A 16: 23,969,986 D544V possibly damaging Het
Ccdc9 A T 7: 16,280,730 D195E probably damaging Het
Cd38 A G 5: 43,868,883 N3S probably benign Het
Cfap46 A T 7: 139,632,181 probably null Het
Cmtr2 T C 8: 110,221,412 F118S probably damaging Het
Cyp7a1 A G 4: 6,268,378 F449S probably damaging Het
Dnah10 C T 5: 124,743,629 A509V probably benign Het
Dsp A T 13: 38,194,889 Q1271L probably damaging Het
E330021D16Rik T A 6: 136,401,373 Y153F probably benign Het
Edar A C 10: 58,607,452 V284G possibly damaging Het
Fdft1 A G 14: 63,151,301 V294A probably damaging Het
Gba T A 3: 89,205,471 V140E probably benign Het
Gm12185 A T 11: 48,915,739 S208R probably benign Het
Gm21028 C A 7: 42,578,522 E23* probably null Het
Gm6871 A G 7: 41,573,568 L32P probably benign Het
Hhip C T 8: 79,997,591 V341M probably damaging Het
Kcnq2 C A 2: 181,135,020 V25L probably damaging Het
Krit1 C A 5: 3,831,551 H548N probably damaging Het
Kynu C T 2: 43,589,394 A100V probably benign Het
Lpp T C 16: 24,889,804 C295R probably damaging Het
Mdp1 A G 14: 55,660,349 V9A probably damaging Het
Mllt3 T C 4: 87,840,856 I318M possibly damaging Het
Mpzl3 A G 9: 45,055,212 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mup8 A G 4: 60,222,423 V16A probably benign Het
Myh13 T A 11: 67,344,790 probably null Het
Myh4 A T 11: 67,259,324 Q1869L probably damaging Het
Nt5c G A 11: 115,490,817 probably null Het
Olfr1173 C A 2: 88,274,632 C139F probably damaging Het
Olfr573-ps1 T A 7: 102,942,512 M22L probably benign Het
Olfr908 CACAACAACA CACAACA 9: 38,516,138 probably benign Het
Parp11 T C 6: 127,470,792 F30L probably damaging Het
Pcdhgc3 A T 18: 37,808,454 D636V possibly damaging Het
Ppp1cb T C 5: 32,485,988 F234L probably damaging Het
Rras2 A T 7: 114,050,337 V164E probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGACGGCGGCG 7: 97,579,913 probably benign Het
Scg3 T C 9: 75,661,301 T390A probably damaging Het
Shh C A 5: 28,466,690 C25F probably damaging Het
Slc24a1 T C 9: 64,949,268 K119R unknown Het
Speg G T 1: 75,431,393 R3244L possibly damaging Het
Spns1 A G 7: 126,373,764 probably benign Het
Sptbn4 A C 7: 27,359,741 probably null Het
Stap1 T A 5: 86,096,516 F214Y possibly damaging Het
Tcerg1 T A 18: 42,519,535 M76K unknown Het
Tjp1 A T 7: 65,313,311 Y959* probably null Het
Tmprss11e A T 5: 86,727,366 C14S probably benign Het
Tnfrsf14 T C 4: 154,922,477 probably null Het
Tsfm A C 10: 127,011,643 V193G probably benign Het
Ush2a A T 1: 188,443,070 I1122L probably benign Het
Vmn1r74 T A 7: 11,847,057 S95T probably damaging Het
Vmn2r98 G A 17: 19,069,753 C517Y probably damaging Het
Vstm2b G A 7: 40,901,278 S99N possibly damaging Het
Zbtb24 A G 10: 41,451,541 N141S probably benign Het
Zcchc4 T G 5: 52,785,170 C106G probably benign Het
Other mutations in Olfr156
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02508:Olfr156 APN 4 43821289 missense possibly damaging 0.83
IGL02690:Olfr156 APN 4 43821190 missense possibly damaging 0.50
R1454:Olfr156 UTSW 4 43820639 missense probably damaging 1.00
R1465:Olfr156 UTSW 4 43820723 missense probably benign 0.00
R1465:Olfr156 UTSW 4 43820723 missense probably benign 0.00
R1859:Olfr156 UTSW 4 43820779 missense possibly damaging 0.91
R2146:Olfr156 UTSW 4 43821178 missense probably damaging 1.00
R3160:Olfr156 UTSW 4 43820544 missense probably benign 0.04
R3162:Olfr156 UTSW 4 43820544 missense probably benign 0.04
R3162:Olfr156 UTSW 4 43820544 missense probably benign 0.04
R3414:Olfr156 UTSW 4 43821258 missense probably benign 0.00
R3936:Olfr156 UTSW 4 43821359 start codon destroyed probably benign 0.01
R4497:Olfr156 UTSW 4 43821175 missense probably damaging 1.00
R4631:Olfr156 UTSW 4 43820563 missense probably benign 0.08
R5125:Olfr156 UTSW 4 43820480 missense probably benign 0.15
R5698:Olfr156 UTSW 4 43821183 missense probably damaging 1.00
R5807:Olfr156 UTSW 4 43820912 missense probably benign 0.00
R5889:Olfr156 UTSW 4 43820492 missense possibly damaging 0.89
R6461:Olfr156 UTSW 4 43821355 missense probably benign
R6865:Olfr156 UTSW 4 43821346 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGCACCAAGGAGTTAGCACC -3'
(R):5'- GGAGAAAACCTTCTTCGTGCTC -3'

Sequencing Primer
(F):5'- CAAGGAGTTAGCACCGCCAG -3'
(R):5'- ATCCTGCTGATGTACCTGGTGATC -3'
Posted On2016-09-06