Incidental Mutation 'R5371:Ccdc9'
ID428722
Institutional Source Beutler Lab
Gene Symbol Ccdc9
Ensembl Gene ENSMUSG00000041375
Gene Namecoiled-coil domain containing 9
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R5371 (G1)
Quality Score199
Status Validated
Chromosome7
Chromosomal Location16274042-16286795 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 16280730 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 195 (D195E)
Ref Sequence ENSEMBL: ENSMUSP00000035597 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041010] [ENSMUST00000118976] [ENSMUST00000145519] [ENSMUST00000146609] [ENSMUST00000148741] [ENSMUST00000150528] [ENSMUST00000174270]
Predicted Effect probably damaging
Transcript: ENSMUST00000041010
AA Change: D195E

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000035597
Gene: ENSMUSG00000041375
AA Change: D195E

DomainStartEndE-ValueType
coiled coil region 5 52 N/A INTRINSIC
low complexity region 75 95 N/A INTRINSIC
low complexity region 121 135 N/A INTRINSIC
coiled coil region 150 184 N/A INTRINSIC
Pfam:DUF4594 203 378 1.1e-63 PFAM
coiled coil region 425 453 N/A INTRINSIC
low complexity region 490 507 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000118976
AA Change: D195E

PolyPhen 2 Score 0.964 (Sensitivity: 0.78; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000114088
Gene: ENSMUSG00000041375
AA Change: D195E

DomainStartEndE-ValueType
coiled coil region 5 52 N/A INTRINSIC
low complexity region 75 95 N/A INTRINSIC
low complexity region 121 135 N/A INTRINSIC
coiled coil region 150 184 N/A INTRINSIC
Pfam:DUF4594 204 375 6.3e-57 PFAM
coiled coil region 425 453 N/A INTRINSIC
low complexity region 490 507 N/A INTRINSIC
low complexity region 535 549 N/A INTRINSIC
low complexity region 580 588 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124084
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129447
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131963
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137993
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144186
Predicted Effect probably benign
Transcript: ENSMUST00000145519
Predicted Effect probably benign
Transcript: ENSMUST00000146085
SMART Domains Protein: ENSMUSP00000134049
Gene: ENSMUSG00000041375

DomainStartEndE-ValueType
Pfam:DUF4594 1 85 5.2e-16 PFAM
coiled coil region 135 163 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000146609
Predicted Effect probably benign
Transcript: ENSMUST00000148741
Predicted Effect probably benign
Transcript: ENSMUST00000150528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000172670
Predicted Effect probably benign
Transcript: ENSMUST00000174270
SMART Domains Protein: ENSMUSP00000133798
Gene: ENSMUSG00000041375

DomainStartEndE-ValueType
coiled coil region 5 52 N/A INTRINSIC
low complexity region 75 95 N/A INTRINSIC
Meta Mutation Damage Score 0.0372 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 96% (71/74)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik G T 7: 29,562,493 noncoding transcript Het
Arpp21 G A 9: 112,065,932 P755S probably benign Het
Aspm C T 1: 139,470,541 Q982* probably null Het
Atp5e C T 2: 174,462,526 probably benign Het
BC024139 A G 15: 76,120,686 *598Q probably null Het
Bcl6 T A 16: 23,969,986 D544V possibly damaging Het
Cd38 A G 5: 43,868,883 N3S probably benign Het
Cfap46 A T 7: 139,632,181 probably null Het
Cmtr2 T C 8: 110,221,412 F118S probably damaging Het
Cyp7a1 A G 4: 6,268,378 F449S probably damaging Het
Dnah10 C T 5: 124,743,629 A509V probably benign Het
Dsp A T 13: 38,194,889 Q1271L probably damaging Het
E330021D16Rik T A 6: 136,401,373 Y153F probably benign Het
Edar A C 10: 58,607,452 V284G possibly damaging Het
Fdft1 A G 14: 63,151,301 V294A probably damaging Het
Gba T A 3: 89,205,471 V140E probably benign Het
Gm12185 A T 11: 48,915,739 S208R probably benign Het
Gm21028 C A 7: 42,578,522 E23* probably null Het
Gm6871 A G 7: 41,573,568 L32P probably benign Het
Hhip C T 8: 79,997,591 V341M probably damaging Het
Kcnq2 C A 2: 181,135,020 V25L probably damaging Het
Krit1 C A 5: 3,831,551 H548N probably damaging Het
Kynu C T 2: 43,589,394 A100V probably benign Het
Lpp T C 16: 24,889,804 C295R probably damaging Het
Mdp1 A G 14: 55,660,349 V9A probably damaging Het
Mllt3 T C 4: 87,840,856 I318M possibly damaging Het
Mpzl3 A G 9: 45,055,212 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mup8 A G 4: 60,222,423 V16A probably benign Het
Myh13 T A 11: 67,344,790 probably null Het
Myh4 A T 11: 67,259,324 Q1869L probably damaging Het
Nt5c G A 11: 115,490,817 probably null Het
Olfr1173 C A 2: 88,274,632 C139F probably damaging Het
Olfr156 A T 4: 43,821,058 M101K probably damaging Het
Olfr573-ps1 T A 7: 102,942,512 M22L probably benign Het
Olfr908 CACAACAACA CACAACA 9: 38,516,138 probably benign Het
Parp11 T C 6: 127,470,792 F30L probably damaging Het
Pcdhgc3 A T 18: 37,808,454 D636V possibly damaging Het
Ppp1cb T C 5: 32,485,988 F234L probably damaging Het
Rras2 A T 7: 114,050,337 V164E probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGACGGCGGCG 7: 97,579,913 probably benign Het
Scg3 T C 9: 75,661,301 T390A probably damaging Het
Shh C A 5: 28,466,690 C25F probably damaging Het
Slc24a1 T C 9: 64,949,268 K119R unknown Het
Speg G T 1: 75,431,393 R3244L possibly damaging Het
Spns1 A G 7: 126,373,764 probably benign Het
Sptbn4 A C 7: 27,359,741 probably null Het
Stap1 T A 5: 86,096,516 F214Y possibly damaging Het
Tcerg1 T A 18: 42,519,535 M76K unknown Het
Tjp1 A T 7: 65,313,311 Y959* probably null Het
Tmprss11e A T 5: 86,727,366 C14S probably benign Het
Tnfrsf14 T C 4: 154,922,477 probably null Het
Tsfm A C 10: 127,011,643 V193G probably benign Het
Ush2a A T 1: 188,443,070 I1122L probably benign Het
Vmn1r74 T A 7: 11,847,057 S95T probably damaging Het
Vmn2r98 G A 17: 19,069,753 C517Y probably damaging Het
Vstm2b G A 7: 40,901,278 S99N possibly damaging Het
Zbtb24 A G 10: 41,451,541 N141S probably benign Het
Zcchc4 T G 5: 52,785,170 C106G probably benign Het
Other mutations in Ccdc9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01387:Ccdc9 APN 7 16284499 start codon destroyed probably null 0.01
IGL02167:Ccdc9 APN 7 16284359 nonsense probably null
IGL02513:Ccdc9 APN 7 16284509 utr 5 prime probably benign
IGL02805:Ccdc9 APN 7 16275274 missense probably benign 0.01
R0537:Ccdc9 UTSW 7 16280776 unclassified probably benign
R0631:Ccdc9 UTSW 7 16278459 missense probably damaging 1.00
R1340:Ccdc9 UTSW 7 16275390 unclassified probably benign
R1758:Ccdc9 UTSW 7 16276236 missense probably damaging 0.99
R2067:Ccdc9 UTSW 7 16278550 splice site probably null
R2207:Ccdc9 UTSW 7 16284269 critical splice donor site probably benign
R5278:Ccdc9 UTSW 7 16278381 nonsense probably null
R7341:Ccdc9 UTSW 7 16280627 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAAAGCAAGCCCTGGTCTG -3'
(R):5'- TCTTTCTGACAGCCATGTGC -3'

Sequencing Primer
(F):5'- AAGCCCTGGTCTGCCCAC -3'
(R):5'- GCGCAGGCAGAATATCGAG -3'
Posted On2016-09-06