Incidental Mutation 'R5371:4930432E11Rik'
List |< first << previous [record 58 of 1920] next >> last >|
ID428724
Institutional Source Beutler Lab
Gene Symbol 4930432E11Rik
Ensembl Gene ENSMUSG00000046958
Gene NameRIKEN cDNA 4930432E11 gene
Synonyms
Accession Numbers

NCBI RefSeq: none; Ensembl: ENSMUST00000053635; MGI:3045259

Is this an essential gene? Probably non essential (E-score: 0.133) question?
Stock #R5371 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location29558579-29582169 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) G to T at 29562493 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s):
Predicted Effect noncoding transcript
Transcript: ENSMUST00000053635
SMART Domains Protein: ENSMUSP00000049518
Gene: ENSMUSG00000046958

DomainStartEndE-ValueType
Blast:WD40 43 79 3e-11 BLAST
WD40 131 172 1.97e2 SMART
WD40 175 214 2.24e-2 SMART
Blast:WD40 257 296 4e-15 BLAST
WD40 393 437 1.32e2 SMART
WD40 494 533 2.15e-4 SMART
low complexity region 598 617 N/A INTRINSIC
low complexity region 1082 1094 N/A INTRINSIC
low complexity region 1107 1148 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000063585
SMART Domains Protein: ENSMUSP00000063695
Gene: ENSMUSG00000051976

DomainStartEndE-ValueType
low complexity region 15 28 N/A INTRINSIC
internal_repeat_1 35 67 3.29e-5 PROSPERO
internal_repeat_1 73 102 3.29e-5 PROSPERO
low complexity region 122 135 N/A INTRINSIC
coiled coil region 161 182 N/A INTRINSIC
low complexity region 216 233 N/A INTRINSIC
low complexity region 239 249 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185541
Meta Mutation Damage Score 0.0456 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 96% (71/74)
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arpp21 G A 9: 112,065,932 P755S probably benign Het
Aspm C T 1: 139,470,541 Q982* probably null Het
Atp5e C T 2: 174,462,526 probably benign Het
BC024139 A G 15: 76,120,686 *598Q probably null Het
Bcl6 T A 16: 23,969,986 D544V possibly damaging Het
Ccdc9 A T 7: 16,280,730 D195E probably damaging Het
Cd38 A G 5: 43,868,883 N3S probably benign Het
Cfap46 A T 7: 139,632,181 probably null Het
Cmtr2 T C 8: 110,221,412 F118S probably damaging Het
Cyp7a1 A G 4: 6,268,378 F449S probably damaging Het
Dnah10 C T 5: 124,743,629 A509V probably benign Het
Dsp A T 13: 38,194,889 Q1271L probably damaging Het
E330021D16Rik T A 6: 136,401,373 Y153F probably benign Het
Edar A C 10: 58,607,452 V284G possibly damaging Het
Fdft1 A G 14: 63,151,301 V294A probably damaging Het
Gba T A 3: 89,205,471 V140E probably benign Het
Gm12185 A T 11: 48,915,739 S208R probably benign Het
Gm21028 C A 7: 42,578,522 E23* probably null Het
Gm6871 A G 7: 41,573,568 L32P probably benign Het
Hhip C T 8: 79,997,591 V341M probably damaging Het
Kcnq2 C A 2: 181,135,020 V25L probably damaging Het
Krit1 C A 5: 3,831,551 H548N probably damaging Het
Kynu C T 2: 43,589,394 A100V probably benign Het
Lpp T C 16: 24,889,804 C295R probably damaging Het
Mdp1 A G 14: 55,660,349 V9A probably damaging Het
Mllt3 T C 4: 87,840,856 I318M possibly damaging Het
Mpzl3 A G 9: 45,055,212 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mup8 A G 4: 60,222,423 V16A probably benign Het
Myh13 T A 11: 67,344,790 probably null Het
Myh4 A T 11: 67,259,324 Q1869L probably damaging Het
Nt5c G A 11: 115,490,817 probably null Het
Olfr1173 C A 2: 88,274,632 C139F probably damaging Het
Olfr156 A T 4: 43,821,058 M101K probably damaging Het
Olfr573-ps1 T A 7: 102,942,512 M22L probably benign Het
Olfr908 CACAACAACA CACAACA 9: 38,516,138 probably benign Het
Parp11 T C 6: 127,470,792 F30L probably damaging Het
Pcdhgc3 A T 18: 37,808,454 D636V possibly damaging Het
Ppp1cb T C 5: 32,485,988 F234L probably damaging Het
Rras2 A T 7: 114,050,337 V164E probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGACGGCGGCG 7: 97,579,913 probably benign Het
Scg3 T C 9: 75,661,301 T390A probably damaging Het
Shh C A 5: 28,466,690 C25F probably damaging Het
Slc24a1 T C 9: 64,949,268 K119R unknown Het
Speg G T 1: 75,431,393 R3244L possibly damaging Het
Spns1 A G 7: 126,373,764 probably benign Het
Sptbn4 A C 7: 27,359,741 probably null Het
Stap1 T A 5: 86,096,516 F214Y possibly damaging Het
Tcerg1 T A 18: 42,519,535 M76K unknown Het
Tjp1 A T 7: 65,313,311 Y959* probably null Het
Tmprss11e A T 5: 86,727,366 C14S probably benign Het
Tnfrsf14 T C 4: 154,922,477 probably null Het
Tsfm A C 10: 127,011,643 V193G probably benign Het
Ush2a A T 1: 188,443,070 I1122L probably benign Het
Vmn1r74 T A 7: 11,847,057 S95T probably damaging Het
Vmn2r98 G A 17: 19,069,753 C517Y probably damaging Het
Vstm2b G A 7: 40,901,278 S99N possibly damaging Het
Zbtb24 A G 10: 41,451,541 N141S probably benign Het
Zcchc4 T G 5: 52,785,170 C106G probably benign Het
Other mutations in 4930432E11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01121:4930432E11Rik APN 7 29574001 unclassified noncoding transcript
IGL01955:4930432E11Rik APN 7 29573995 unclassified noncoding transcript
IGL01971:4930432E11Rik APN 7 29574562 unclassified noncoding transcript
IGL02132:4930432E11Rik APN 7 29563279 unclassified noncoding transcript
IGL02484:4930432E11Rik APN 7 29563352 unclassified noncoding transcript
P0016:4930432E11Rik UTSW 7 29563112 unclassified noncoding transcript
R0051:4930432E11Rik UTSW 7 29579101 exon noncoding transcript
R0060:4930432E11Rik UTSW 7 29574170 unclassified noncoding transcript
R0094:4930432E11Rik UTSW 7 29560811 exon noncoding transcript
R0268:4930432E11Rik UTSW 7 29574602 unclassified noncoding transcript
R0423:4930432E11Rik UTSW 7 29562400 exon noncoding transcript
R0478:4930432E11Rik UTSW 7 29562589 exon noncoding transcript
R0646:4930432E11Rik UTSW 7 29561285 exon noncoding transcript
R1208:4930432E11Rik UTSW 7 29561283 exon noncoding transcript
R1778:4930432E11Rik UTSW 7 29560706 exon noncoding transcript
R1779:4930432E11Rik UTSW 7 29579166 exon noncoding transcript
R1918:4930432E11Rik UTSW 7 29574089 unclassified noncoding transcript
R2360:4930432E11Rik UTSW 7 29574789 unclassified noncoding transcript
R3736:4930432E11Rik UTSW 7 29574571 unclassified noncoding transcript
R3780:4930432E11Rik UTSW 7 29560838 exon noncoding transcript
R4427:4930432E11Rik UTSW 7 29579253 exon noncoding transcript
R4835:4930432E11Rik UTSW 7 29574901 unclassified noncoding transcript
R4929:4930432E11Rik UTSW 7 29574042 unclassified noncoding transcript
R5042:4930432E11Rik UTSW 7 29574502 unclassified noncoding transcript
R5129:4930432E11Rik UTSW 7 29561361 exon noncoding transcript
R5381:4930432E11Rik UTSW 7 29562968 unclassified noncoding transcript
R5586:4930432E11Rik UTSW 7 29577728 unclassified noncoding transcript
R5874:4930432E11Rik UTSW 7 29581185 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TACGATAGAGACCCCAAGGC -3'
(R):5'- AGCACGGATCACTGAGTTAGG -3'

Sequencing Primer
(F):5'- GATAGAGACCCCAAGGCCCTTC -3'
(R):5'- ATCTGGAGCGAAGGGCCATTTC -3'
Posted On2016-09-06