Incidental Mutation 'R5371:Olfr908'
ID428734
Institutional Source Beutler Lab
Gene Symbol Olfr908
Ensembl Gene ENSMUSG00000063732
Gene Nameolfactory receptor 908
SynonymsMOR165-2, GA_x6K02T2PVTD-32216179-32217111
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.141) question?
Stock #R5371 (G1)
Quality Score217
Status Validated
Chromosome9
Chromosomal Location38516034-38516965 bp(+) (GRCm38)
Type of Mutationsmall deletion (1 aa in frame mutation)
DNA Base Change (assembly) CACAACAACA to CACAACA at 38516138 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151016 (fasta)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000075798
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104052
Predicted Effect probably benign
Transcript: ENSMUST00000215139
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 96% (71/74)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik G T 7: 29,562,493 noncoding transcript Het
Arpp21 G A 9: 112,065,932 P755S probably benign Het
Aspm C T 1: 139,470,541 Q982* probably null Het
Atp5e C T 2: 174,462,526 probably benign Het
BC024139 A G 15: 76,120,686 *598Q probably null Het
Bcl6 T A 16: 23,969,986 D544V possibly damaging Het
Ccdc9 A T 7: 16,280,730 D195E probably damaging Het
Cd38 A G 5: 43,868,883 N3S probably benign Het
Cfap46 A T 7: 139,632,181 probably null Het
Cmtr2 T C 8: 110,221,412 F118S probably damaging Het
Cyp7a1 A G 4: 6,268,378 F449S probably damaging Het
Dnah10 C T 5: 124,743,629 A509V probably benign Het
Dsp A T 13: 38,194,889 Q1271L probably damaging Het
E330021D16Rik T A 6: 136,401,373 Y153F probably benign Het
Edar A C 10: 58,607,452 V284G possibly damaging Het
Fdft1 A G 14: 63,151,301 V294A probably damaging Het
Gba T A 3: 89,205,471 V140E probably benign Het
Gm12185 A T 11: 48,915,739 S208R probably benign Het
Gm21028 C A 7: 42,578,522 E23* probably null Het
Gm6871 A G 7: 41,573,568 L32P probably benign Het
Hhip C T 8: 79,997,591 V341M probably damaging Het
Kcnq2 C A 2: 181,135,020 V25L probably damaging Het
Krit1 C A 5: 3,831,551 H548N probably damaging Het
Kynu C T 2: 43,589,394 A100V probably benign Het
Lpp T C 16: 24,889,804 C295R probably damaging Het
Mdp1 A G 14: 55,660,349 V9A probably damaging Het
Mllt3 T C 4: 87,840,856 I318M possibly damaging Het
Mpzl3 A G 9: 45,055,212 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mup8 A G 4: 60,222,423 V16A probably benign Het
Myh13 T A 11: 67,344,790 probably null Het
Myh4 A T 11: 67,259,324 Q1869L probably damaging Het
Nt5c G A 11: 115,490,817 probably null Het
Olfr1173 C A 2: 88,274,632 C139F probably damaging Het
Olfr156 A T 4: 43,821,058 M101K probably damaging Het
Olfr573-ps1 T A 7: 102,942,512 M22L probably benign Het
Parp11 T C 6: 127,470,792 F30L probably damaging Het
Pcdhgc3 A T 18: 37,808,454 D636V possibly damaging Het
Ppp1cb T C 5: 32,485,988 F234L probably damaging Het
Rras2 A T 7: 114,050,337 V164E probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGACGGCGGCG 7: 97,579,913 probably benign Het
Scg3 T C 9: 75,661,301 T390A probably damaging Het
Shh C A 5: 28,466,690 C25F probably damaging Het
Slc24a1 T C 9: 64,949,268 K119R unknown Het
Speg G T 1: 75,431,393 R3244L possibly damaging Het
Spns1 A G 7: 126,373,764 probably benign Het
Sptbn4 A C 7: 27,359,741 probably null Het
Stap1 T A 5: 86,096,516 F214Y possibly damaging Het
Tcerg1 T A 18: 42,519,535 M76K unknown Het
Tjp1 A T 7: 65,313,311 Y959* probably null Het
Tmprss11e A T 5: 86,727,366 C14S probably benign Het
Tnfrsf14 T C 4: 154,922,477 probably null Het
Tsfm A C 10: 127,011,643 V193G probably benign Het
Ush2a A T 1: 188,443,070 I1122L probably benign Het
Vmn1r74 T A 7: 11,847,057 S95T probably damaging Het
Vmn2r98 G A 17: 19,069,753 C517Y probably damaging Het
Vstm2b G A 7: 40,901,278 S99N possibly damaging Het
Zbtb24 A G 10: 41,451,541 N141S probably benign Het
Zcchc4 T G 5: 52,785,170 C106G probably benign Het
Other mutations in Olfr908
AlleleSourceChrCoordTypePredicted EffectPPH Score
R4656:Olfr908 UTSW 9 38516556 missense probably damaging 1.00
R4772:Olfr908 UTSW 9 38516601 unclassified probably benign
R4795:Olfr908 UTSW 9 38516503 missense probably damaging 0.98
R5296:Olfr908 UTSW 9 38516116 missense probably damaging 1.00
R5325:Olfr908 UTSW 9 38516158 missense probably damaging 1.00
R5374:Olfr908 UTSW 9 38516138 small deletion probably benign
R5473:Olfr908 UTSW 9 38516212 missense probably damaging 1.00
R6761:Olfr908 UTSW 9 38516265 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTATGCTAGTAATTTCATGTGCCC -3'
(R):5'- GGCCATTGATGACAGAACAC -3'

Sequencing Primer
(F):5'- CATGTGCCCTTATAATTGTCACAG -3'
(R):5'- GCTGGGTCATACATCCTACATAGG -3'
Posted On2016-09-06