Incidental Mutation 'R5371:Lpp'
ID428751
Institutional Source Beutler Lab
Gene Symbol Lpp
Ensembl Gene ENSMUSG00000033306
Gene NameLIM domain containing preferred translocation partner in lipoma
SynonymsB130055L10Rik, 9430020K16Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.145) question?
Stock #R5371 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location24393507-24992578 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 24889804 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 295 (C295R)
Ref Sequence ENSEMBL: ENSMUSP00000110969 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038053] [ENSMUST00000078988] [ENSMUST00000115314] [ENSMUST00000232546]
Predicted Effect probably damaging
Transcript: ENSMUST00000038053
AA Change: C420R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000036304
Gene: ENSMUSG00000033306
AA Change: C420R

DomainStartEndE-ValueType
low complexity region 41 55 N/A INTRINSIC
low complexity region 61 93 N/A INTRINSIC
coiled coil region 109 134 N/A INTRINSIC
low complexity region 174 197 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
LIM 416 469 1.03e-16 SMART
LIM 476 528 1.94e-12 SMART
LIM 536 597 2.5e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000078988
AA Change: C420R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000078005
Gene: ENSMUSG00000033306
AA Change: C420R

DomainStartEndE-ValueType
low complexity region 41 55 N/A INTRINSIC
low complexity region 61 93 N/A INTRINSIC
coiled coil region 109 134 N/A INTRINSIC
low complexity region 174 197 N/A INTRINSIC
low complexity region 255 267 N/A INTRINSIC
low complexity region 371 386 N/A INTRINSIC
LIM 416 469 1.03e-16 SMART
LIM 476 528 1.94e-12 SMART
LIM 536 597 2.5e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000115314
AA Change: C295R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000110969
Gene: ENSMUSG00000033306
AA Change: C295R

DomainStartEndE-ValueType
low complexity region 49 72 N/A INTRINSIC
low complexity region 130 142 N/A INTRINSIC
low complexity region 246 261 N/A INTRINSIC
LIM 291 344 1.03e-16 SMART
LIM 351 403 1.94e-12 SMART
LIM 411 472 2.5e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000232546
Meta Mutation Damage Score 0.406 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 96% (71/74)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of a subfamily of LIM domain proteins that are characterized by an N-terminal proline-rich region and three C-terminal LIM domains. The encoded protein localizes to the cell periphery in focal adhesions and may be involved in cell-cell adhesion and cell motility. This protein also shuttles through the nucleus and may function as a transcriptional co-activator. This gene is located at the junction of certain disease-related chromosomal translocations, which result in the expression of chimeric proteins that may promote tumor growth. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2014]
PHENOTYPE: Gene disruption results in fertility problems involving females but not males. Migration and survival of MEFs are also abnormal. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 59 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930432E11Rik G T 7: 29,562,493 noncoding transcript Het
Arpp21 G A 9: 112,065,932 P755S probably benign Het
Aspm C T 1: 139,470,541 Q982* probably null Het
Atp5e C T 2: 174,462,526 probably benign Het
BC024139 A G 15: 76,120,686 *598Q probably null Het
Bcl6 T A 16: 23,969,986 D544V possibly damaging Het
Ccdc9 A T 7: 16,280,730 D195E probably damaging Het
Cd38 A G 5: 43,868,883 N3S probably benign Het
Cfap46 A T 7: 139,632,181 probably null Het
Cmtr2 T C 8: 110,221,412 F118S probably damaging Het
Cyp7a1 A G 4: 6,268,378 F449S probably damaging Het
Dnah10 C T 5: 124,743,629 A509V probably benign Het
Dsp A T 13: 38,194,889 Q1271L probably damaging Het
E330021D16Rik T A 6: 136,401,373 Y153F probably benign Het
Edar A C 10: 58,607,452 V284G possibly damaging Het
Fdft1 A G 14: 63,151,301 V294A probably damaging Het
Gba T A 3: 89,205,471 V140E probably benign Het
Gm12185 A T 11: 48,915,739 S208R probably benign Het
Gm21028 C A 7: 42,578,522 E23* probably null Het
Gm6871 A G 7: 41,573,568 L32P probably benign Het
Hhip C T 8: 79,997,591 V341M probably damaging Het
Kcnq2 C A 2: 181,135,020 V25L probably damaging Het
Krit1 C A 5: 3,831,551 H548N probably damaging Het
Kynu C T 2: 43,589,394 A100V probably benign Het
Mdp1 A G 14: 55,660,349 V9A probably damaging Het
Mllt3 T C 4: 87,840,856 I318M possibly damaging Het
Mpzl3 A G 9: 45,055,212 probably benign Het
Mroh2a A G 1: 88,258,664 S64G probably benign Het
Mup8 A G 4: 60,222,423 V16A probably benign Het
Myh13 T A 11: 67,344,790 probably null Het
Myh4 A T 11: 67,259,324 Q1869L probably damaging Het
Nt5c G A 11: 115,490,817 probably null Het
Olfr1173 C A 2: 88,274,632 C139F probably damaging Het
Olfr156 A T 4: 43,821,058 M101K probably damaging Het
Olfr573-ps1 T A 7: 102,942,512 M22L probably benign Het
Olfr908 CACAACAACA CACAACA 9: 38,516,138 probably benign Het
Parp11 T C 6: 127,470,792 F30L probably damaging Het
Pcdhgc3 A T 18: 37,808,454 D636V possibly damaging Het
Ppp1cb T C 5: 32,485,988 F234L probably damaging Het
Rras2 A T 7: 114,050,337 V164E probably damaging Het
Rsf1 GCGGCGGCG GCGGCGGCGACGGCGGCG 7: 97,579,913 probably benign Het
Scg3 T C 9: 75,661,301 T390A probably damaging Het
Shh C A 5: 28,466,690 C25F probably damaging Het
Slc24a1 T C 9: 64,949,268 K119R unknown Het
Speg G T 1: 75,431,393 R3244L possibly damaging Het
Spns1 A G 7: 126,373,764 probably benign Het
Sptbn4 A C 7: 27,359,741 probably null Het
Stap1 T A 5: 86,096,516 F214Y possibly damaging Het
Tcerg1 T A 18: 42,519,535 M76K unknown Het
Tjp1 A T 7: 65,313,311 Y959* probably null Het
Tmprss11e A T 5: 86,727,366 C14S probably benign Het
Tnfrsf14 T C 4: 154,922,477 probably null Het
Tsfm A C 10: 127,011,643 V193G probably benign Het
Ush2a A T 1: 188,443,070 I1122L probably benign Het
Vmn1r74 T A 7: 11,847,057 S95T probably damaging Het
Vmn2r98 G A 17: 19,069,753 C517Y probably damaging Het
Vstm2b G A 7: 40,901,278 S99N possibly damaging Het
Zbtb24 A G 10: 41,451,541 N141S probably benign Het
Zcchc4 T G 5: 52,785,170 C106G probably benign Het
Other mutations in Lpp
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00588:Lpp APN 16 24845188 missense probably damaging 1.00
IGL01354:Lpp APN 16 24762066 nonsense probably null
IGL02141:Lpp APN 16 24761615 missense probably damaging 0.98
IGL02182:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02230:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02232:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02234:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02236:Lpp APN 16 24762145 missense probably damaging 0.99
IGL02371:Lpp APN 16 24761611 missense probably damaging 0.96
IGL03265:Lpp APN 16 24761987 missense probably damaging 1.00
PIT4585001:Lpp UTSW 16 24761947 missense probably benign 0.23
R0047:Lpp UTSW 16 24661800 splice site probably benign
R0047:Lpp UTSW 16 24661800 splice site probably benign
R0092:Lpp UTSW 16 24761602 missense probably benign 0.01
R0385:Lpp UTSW 16 24761837 missense probably damaging 1.00
R0389:Lpp UTSW 16 24608241 missense probably damaging 1.00
R0504:Lpp UTSW 16 24971970 missense probably damaging 1.00
R0798:Lpp UTSW 16 24971872 nonsense probably null
R1199:Lpp UTSW 16 24681860 missense probably damaging 1.00
R1581:Lpp UTSW 16 24681841 nonsense probably null
R1755:Lpp UTSW 16 24845124 missense probably benign
R1848:Lpp UTSW 16 24761655 missense probably damaging 1.00
R1980:Lpp UTSW 16 24661701 missense probably damaging 1.00
R3432:Lpp UTSW 16 24889886 missense probably benign 0.04
R3755:Lpp UTSW 16 24845161 missense probably benign 0.00
R4078:Lpp UTSW 16 24681861 missense probably damaging 1.00
R4214:Lpp UTSW 16 24762054 nonsense probably null
R4712:Lpp UTSW 16 24761657 missense possibly damaging 0.94
R4806:Lpp UTSW 16 24661680 missense probably damaging 0.97
R4968:Lpp UTSW 16 24979314 missense probably damaging 1.00
R5047:Lpp UTSW 16 24971846 missense probably damaging 1.00
R5536:Lpp UTSW 16 24845206 missense possibly damaging 0.54
R5875:Lpp UTSW 16 24608309 missense probably benign 0.10
R7285:Lpp UTSW 16 24977279 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTGCCTTCTCAGGAGCCTTAG -3'
(R):5'- CTAATGTGGCAACTTACAATGTAGC -3'

Sequencing Primer
(F):5'- AGATTCCCGCTATGTGCAG -3'
(R):5'- TTACAATGTAGCAGGGCTCGC -3'
Posted On2016-09-06