Incidental Mutation 'R5372:Rufy4'
ID428758
Institutional Source Beutler Lab
Gene Symbol Rufy4
Ensembl Gene ENSMUSG00000061815
Gene NameRUN and FYVE domain containing 4
Synonyms
MMRRC Submission 042948-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.292) question?
Stock #R5372 (G1)
Quality Score225
Status Validated
Chromosome1
Chromosomal Location74125541-74148223 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 74147663 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Arginine at position 537 (C537R)
Ref Sequence ENSEMBL: ENSMUSP00000115873 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080167] [ENSMUST00000127134]
Predicted Effect probably damaging
Transcript: ENSMUST00000080167
AA Change: C453R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000079062
Gene: ENSMUSG00000061815
AA Change: C453R

DomainStartEndE-ValueType
Pfam:RUN 2 81 1.5e-8 PFAM
coiled coil region 331 404 N/A INTRINSIC
Blast:FYVE 415 472 2e-6 BLAST
SCOP:d1vfya_ 428 473 4e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000127134
AA Change: C537R

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000115873
Gene: ENSMUSG00000061815
AA Change: C537R

DomainStartEndE-ValueType
Pfam:RUN 41 165 6.2e-10 PFAM
coiled coil region 415 488 N/A INTRINSIC
Blast:FYVE 499 556 2e-6 BLAST
SCOP:d1vfya_ 512 557 3e-7 SMART
Meta Mutation Damage Score 0.294 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (89/93)
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,055,339 D108E probably damaging Het
Abhd12b A G 12: 70,181,026 D194G probably damaging Het
Adck5 A G 15: 76,594,507 probably benign Het
Adgrb3 C T 1: 25,128,859 V792I probably benign Het
Anxa8 G A 14: 34,093,911 V174M probably damaging Het
Apol9b A T 15: 77,735,720 R239W probably benign Het
Arhgap26 A G 18: 38,642,456 noncoding transcript Het
Atrnl1 A G 19: 57,755,536 Y1190C probably benign Het
Brinp3 T G 1: 146,831,726 L376R probably damaging Het
Btbd2 A T 10: 80,648,641 M132K probably damaging Het
C130073F10Rik A T 4: 101,890,487 I115K probably damaging Het
C1ra T A 6: 124,521,625 Y426N probably damaging Het
Cacna1b A T 2: 24,733,959 V203E probably damaging Het
Catsperg1 T A 7: 29,210,712 D68V probably benign Het
Ccdc158 A C 5: 92,632,560 S885A possibly damaging Het
Cdc42bpa T C 1: 180,064,979 V236A probably damaging Het
Cdca7 A T 2: 72,482,449 E176D probably damaging Het
Cdk17 A G 10: 93,226,039 D211G probably benign Het
Clca3a2 A C 3: 144,797,525 M888R probably benign Het
Clcn7 T A 17: 25,157,179 M568K possibly damaging Het
Clip1 G T 5: 123,630,240 N811K probably benign Het
Col12a1 T A 9: 79,678,366 Y1243F probably damaging Het
Dctn1 T A 6: 83,190,210 D315E probably damaging Het
Dgcr2 T C 16: 17,872,644 T41A probably benign Het
Dync2h1 G A 9: 7,176,962 probably benign Het
Ep300 A G 15: 81,636,830 I1264V unknown Het
Fam167b A T 4: 129,578,299 L26Q possibly damaging Het
Fam178b T A 1: 36,564,848 I457F possibly damaging Het
Fgd4 A T 16: 16,484,291 N133K probably benign Het
Fndc1 C G 17: 7,765,210 V1295L unknown Het
Gad2 A T 2: 22,690,243 D552V possibly damaging Het
Hars2 T C 18: 36,790,481 Y361H possibly damaging Het
Heca T A 10: 17,915,139 S390C probably damaging Het
Hephl1 G T 9: 15,097,899 Y132* probably null Het
Hormad1 T A 3: 95,576,424 D182E probably damaging Het
Ifna15 G A 4: 88,558,101 P49S probably damaging Het
Khsrp T C 17: 57,024,292 T429A possibly damaging Het
Magi2 A G 5: 20,702,110 Q1094R possibly damaging Het
Map3k11 T A 19: 5,690,962 I239K probably damaging Het
Mtus2 A G 5: 148,313,412 T1319A probably damaging Het
Nup54 A G 5: 92,417,857 I406T probably damaging Het
Nxpe2 T C 9: 48,339,519 T43A possibly damaging Het
Nynrin A G 14: 55,868,491 E889G probably benign Het
Olfr1313 A G 2: 112,072,109 I158T probably benign Het
Olfr160 T C 9: 37,711,938 M114V possibly damaging Het
Olfr301 T A 7: 86,412,968 I202N possibly damaging Het
Olfr663 A G 7: 104,703,795 D76G probably benign Het
Opa1 A C 16: 29,586,119 H45P probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Papola A G 12: 105,827,050 K543R probably benign Het
Plcxd3 G A 15: 4,574,788 V293I probably benign Het
Polr2g T C 19: 8,797,303 Y72C probably damaging Het
Ppp1r21 A G 17: 88,550,675 K205E probably benign Het
Ptpre A G 7: 135,653,940 K53E possibly damaging Het
Rasal3 T C 17: 32,391,344 K990E probably benign Het
Rgs3 A T 4: 62,652,697 probably benign Het
Rhd A G 4: 134,884,632 T254A possibly damaging Het
Scube3 G T 17: 28,152,482 C57F probably damaging Het
Sh2d5 A G 4: 138,254,699 D57G possibly damaging Het
Slc12a6 T A 2: 112,347,360 L608* probably null Het
Slk A T 19: 47,625,393 N896I probably damaging Het
Smc6 A G 12: 11,282,430 D211G probably damaging Het
Sox6 A T 7: 115,550,151 Y371* probably null Het
Srcap G A 7: 127,557,613 probably null Het
Stard5 T A 7: 83,633,220 D80E probably damaging Het
Supv3l1 C T 10: 62,432,357 V570M probably damaging Het
Syt7 G T 19: 10,426,621 V180L probably damaging Het
Tacc2 T A 7: 130,623,260 H558Q probably benign Het
Tas2r120 T A 6: 132,657,483 M176K possibly damaging Het
Tmem135 A T 7: 89,165,174 probably null Het
Trim35 T C 14: 66,297,266 V66A possibly damaging Het
Tspan12 A G 6: 21,772,699 S284P probably benign Het
Ttll3 A T 6: 113,401,421 K257* probably null Het
Uggt1 C A 1: 36,244,060 probably benign Het
Vmn2r7 T A 3: 64,716,324 I283F probably damaging Het
Wdfy2 T G 14: 62,954,885 H363Q probably damaging Het
Wdr4 T A 17: 31,510,580 K95N probably damaging Het
Zfp141 T C 7: 42,477,196 N91S possibly damaging Het
Zfp383 C T 7: 29,915,270 R317* probably null Het
Other mutations in Rufy4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01617:Rufy4 APN 1 74129354 missense probably damaging 1.00
IGL02075:Rufy4 APN 1 74129359 missense probably damaging 1.00
IGL02604:Rufy4 APN 1 74134189 missense probably damaging 1.00
IGL02606:Rufy4 APN 1 74133350 splice site probably benign
IGL02928:Rufy4 APN 1 74129082 unclassified probably benign
R0091:Rufy4 UTSW 1 74128936 unclassified probably benign
R0507:Rufy4 UTSW 1 74146716 missense probably benign 0.02
R0589:Rufy4 UTSW 1 74132883 missense probably damaging 1.00
R0595:Rufy4 UTSW 1 74140930 missense possibly damaging 0.94
R0742:Rufy4 UTSW 1 74146716 missense probably benign 0.02
R1533:Rufy4 UTSW 1 74129843 critical splice donor site probably null
R1666:Rufy4 UTSW 1 74147678 missense probably benign 0.06
R1668:Rufy4 UTSW 1 74147678 missense probably benign 0.06
R1827:Rufy4 UTSW 1 74134120 missense probably damaging 1.00
R2018:Rufy4 UTSW 1 74140947 missense possibly damaging 0.49
R2095:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R2306:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R2307:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R2472:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R2475:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3022:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3054:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3055:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3056:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3117:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3118:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3236:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3237:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3545:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3546:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3547:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3548:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3767:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3768:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3770:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3816:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3817:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3818:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3819:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R3895:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4050:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4091:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4117:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4124:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4125:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4127:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4231:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4233:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4234:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4236:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4254:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4255:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4319:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4320:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4321:Rufy4 UTSW 1 74132784 missense possibly damaging 0.93
R4321:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4322:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4323:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4324:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4360:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4361:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4406:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4408:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4516:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4517:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4520:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4522:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4524:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4531:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4533:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4617:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4661:Rufy4 UTSW 1 74133107 missense probably damaging 0.99
R4778:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4779:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4840:Rufy4 UTSW 1 74129039 missense possibly damaging 0.82
R4897:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4898:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4899:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4915:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4917:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4918:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R4997:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5092:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5097:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5189:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5191:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5195:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5196:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5197:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5226:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5227:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5228:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5230:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5373:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5374:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5375:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5376:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5377:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5378:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5699:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5748:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5750:Rufy4 UTSW 1 74132909 missense probably benign 0.01
R5767:Rufy4 UTSW 1 74147663 missense probably damaging 0.99
R5865:Rufy4 UTSW 1 74146755 missense probably damaging 0.99
R6083:Rufy4 UTSW 1 74129397 missense probably damaging 0.99
R6149:Rufy4 UTSW 1 74147733 missense probably benign 0.15
R6279:Rufy4 UTSW 1 74133224 missense probably benign 0.00
R6300:Rufy4 UTSW 1 74133224 missense probably benign 0.00
R6629:Rufy4 UTSW 1 74132367 intron probably null
R6809:Rufy4 UTSW 1 74133047 missense probably benign 0.00
R7179:Rufy4 UTSW 1 74132876 missense probably benign 0.12
R7218:Rufy4 UTSW 1 74133015 missense probably damaging 0.99
X0023:Rufy4 UTSW 1 74141049 missense probably benign 0.04
X0025:Rufy4 UTSW 1 74133019 missense probably benign
Predicted Primers PCR Primer
(F):5'- AAGCCATCAGGAGAAGCTGC -3'
(R):5'- AGAGCTAGGCCTATCTGTGG -3'

Sequencing Primer
(F):5'- GGAGAAGCTGCCACCTCAATTAG -3'
(R):5'- CTAGGCCTATCTGTGGACTGC -3'
Posted On2016-09-06