Incidental Mutation 'R5372:Slc12a6'
ID428765
Institutional Source Beutler Lab
Gene Symbol Slc12a6
Ensembl Gene ENSMUSG00000027130
Gene Namesolute carrier family 12, member 6
Synonymsgaxp, KCC3
MMRRC Submission 042948-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.255) question?
Stock #R5372 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location112265825-112363163 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) T to A at 112347360 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Stop codon at position 608 (L608*)
Ref Sequence ENSEMBL: ENSMUSP00000124314 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028549] [ENSMUST00000053666] [ENSMUST00000110987] [ENSMUST00000110991] [ENSMUST00000141047]
Predicted Effect probably null
Transcript: ENSMUST00000028549
AA Change: L623*
SMART Domains Protein: ENSMUSP00000028549
Gene: ENSMUSG00000027130
AA Change: L623*

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 114 171 8e-3 SMART
Pfam:AA_permease 190 384 4.1e-25 PFAM
Pfam:AA_permease 453 761 2.3e-43 PFAM
Pfam:SLC12 773 897 7.1e-20 PFAM
Pfam:SLC12 892 1150 3.9e-32 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000053666
AA Change: L572*
SMART Domains Protein: ENSMUSP00000051490
Gene: ENSMUSG00000027130
AA Change: L572*

DomainStartEndE-ValueType
Pfam:AA_permease 139 333 2.3e-25 PFAM
Pfam:AA_permease_2 385 668 1.5e-19 PFAM
Pfam:AA_permease 391 710 4.5e-41 PFAM
low complexity region 828 842 N/A INTRINSIC
Pfam:KCl_Cotrans_1 967 996 2.2e-23 PFAM
low complexity region 1079 1091 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110987
AA Change: L608*
SMART Domains Protein: ENSMUSP00000106615
Gene: ENSMUSG00000027130
AA Change: L608*

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 99 156 4e-3 SMART
Pfam:AA_permease 175 369 3.9e-25 PFAM
Pfam:AA_permease_2 421 704 3.2e-19 PFAM
Pfam:AA_permease 426 746 5.8e-41 PFAM
low complexity region 864 878 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000110991
AA Change: L623*
SMART Domains Protein: ENSMUSP00000106619
Gene: ENSMUSG00000027130
AA Change: L623*

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 114 171 7e-3 SMART
Pfam:AA_permease 190 384 4.2e-25 PFAM
Pfam:AA_permease_2 436 719 2.9e-19 PFAM
Pfam:AA_permease 442 761 8.2e-41 PFAM
low complexity region 879 893 N/A INTRINSIC
Pfam:KCl_Cotrans_1 1018 1047 2.7e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133840
Predicted Effect probably null
Transcript: ENSMUST00000141047
AA Change: L608*
SMART Domains Protein: ENSMUSP00000124314
Gene: ENSMUSG00000096764
AA Change: L608*

DomainStartEndE-ValueType
low complexity region 28 53 N/A INTRINSIC
SCOP:d1qqea_ 99 156 8e-3 SMART
Pfam:AA_permease 175 369 6.6e-25 PFAM
Pfam:AA_permease 438 746 3.6e-43 PFAM
Pfam:SLC12 758 884 6.8e-20 PFAM
Pfam:SLC12 877 1033 5.9e-20 PFAM
Meta Mutation Damage Score 0.598 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (89/93)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the K-Cl cotransporter (KCC) family. K-Cl cotransporters are integral membrane proteins that lower intracellular chloride concentrations below the electrochemical equilibrium potential. The proteins encoded by this gene are activated by cell swelling induced by hypotonic conditions. Alternate splicing results in multiple transcript variants encoding different isoforms. Mutations in this gene are associated with agenesis of the corpus callosum with peripheral neuropathy. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit locomotor deficits, progressive neurodegeneration, slow progressive deafness and failure to breed. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,055,339 D108E probably damaging Het
Abhd12b A G 12: 70,181,026 D194G probably damaging Het
Adck5 A G 15: 76,594,507 probably benign Het
Adgrb3 C T 1: 25,128,859 V792I probably benign Het
Anxa8 G A 14: 34,093,911 V174M probably damaging Het
Apol9b A T 15: 77,735,720 R239W probably benign Het
Arhgap26 A G 18: 38,642,456 noncoding transcript Het
Atrnl1 A G 19: 57,755,536 Y1190C probably benign Het
Brinp3 T G 1: 146,831,726 L376R probably damaging Het
Btbd2 A T 10: 80,648,641 M132K probably damaging Het
C130073F10Rik A T 4: 101,890,487 I115K probably damaging Het
C1ra T A 6: 124,521,625 Y426N probably damaging Het
Cacna1b A T 2: 24,733,959 V203E probably damaging Het
Catsperg1 T A 7: 29,210,712 D68V probably benign Het
Ccdc158 A C 5: 92,632,560 S885A possibly damaging Het
Cdc42bpa T C 1: 180,064,979 V236A probably damaging Het
Cdca7 A T 2: 72,482,449 E176D probably damaging Het
Cdk17 A G 10: 93,226,039 D211G probably benign Het
Clca3a2 A C 3: 144,797,525 M888R probably benign Het
Clcn7 T A 17: 25,157,179 M568K possibly damaging Het
Clip1 G T 5: 123,630,240 N811K probably benign Het
Col12a1 T A 9: 79,678,366 Y1243F probably damaging Het
Dctn1 T A 6: 83,190,210 D315E probably damaging Het
Dgcr2 T C 16: 17,872,644 T41A probably benign Het
Dync2h1 G A 9: 7,176,962 probably benign Het
Ep300 A G 15: 81,636,830 I1264V unknown Het
Fam167b A T 4: 129,578,299 L26Q possibly damaging Het
Fam178b T A 1: 36,564,848 I457F possibly damaging Het
Fgd4 A T 16: 16,484,291 N133K probably benign Het
Fndc1 C G 17: 7,765,210 V1295L unknown Het
Gad2 A T 2: 22,690,243 D552V possibly damaging Het
Hars2 T C 18: 36,790,481 Y361H possibly damaging Het
Heca T A 10: 17,915,139 S390C probably damaging Het
Hephl1 G T 9: 15,097,899 Y132* probably null Het
Hormad1 T A 3: 95,576,424 D182E probably damaging Het
Ifna15 G A 4: 88,558,101 P49S probably damaging Het
Khsrp T C 17: 57,024,292 T429A possibly damaging Het
Magi2 A G 5: 20,702,110 Q1094R possibly damaging Het
Map3k11 T A 19: 5,690,962 I239K probably damaging Het
Mtus2 A G 5: 148,313,412 T1319A probably damaging Het
Nup54 A G 5: 92,417,857 I406T probably damaging Het
Nxpe2 T C 9: 48,339,519 T43A possibly damaging Het
Nynrin A G 14: 55,868,491 E889G probably benign Het
Olfr1313 A G 2: 112,072,109 I158T probably benign Het
Olfr160 T C 9: 37,711,938 M114V possibly damaging Het
Olfr301 T A 7: 86,412,968 I202N possibly damaging Het
Olfr663 A G 7: 104,703,795 D76G probably benign Het
Opa1 A C 16: 29,586,119 H45P probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Papola A G 12: 105,827,050 K543R probably benign Het
Plcxd3 G A 15: 4,574,788 V293I probably benign Het
Polr2g T C 19: 8,797,303 Y72C probably damaging Het
Ppp1r21 A G 17: 88,550,675 K205E probably benign Het
Ptpre A G 7: 135,653,940 K53E possibly damaging Het
Rasal3 T C 17: 32,391,344 K990E probably benign Het
Rgs3 A T 4: 62,652,697 probably benign Het
Rhd A G 4: 134,884,632 T254A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scube3 G T 17: 28,152,482 C57F probably damaging Het
Sh2d5 A G 4: 138,254,699 D57G possibly damaging Het
Slk A T 19: 47,625,393 N896I probably damaging Het
Smc6 A G 12: 11,282,430 D211G probably damaging Het
Sox6 A T 7: 115,550,151 Y371* probably null Het
Srcap G A 7: 127,557,613 probably null Het
Stard5 T A 7: 83,633,220 D80E probably damaging Het
Supv3l1 C T 10: 62,432,357 V570M probably damaging Het
Syt7 G T 19: 10,426,621 V180L probably damaging Het
Tacc2 T A 7: 130,623,260 H558Q probably benign Het
Tas2r120 T A 6: 132,657,483 M176K possibly damaging Het
Tmem135 A T 7: 89,165,174 probably null Het
Trim35 T C 14: 66,297,266 V66A possibly damaging Het
Tspan12 A G 6: 21,772,699 S284P probably benign Het
Ttll3 A T 6: 113,401,421 K257* probably null Het
Uggt1 C A 1: 36,244,060 probably benign Het
Vmn2r7 T A 3: 64,716,324 I283F probably damaging Het
Wdfy2 T G 14: 62,954,885 H363Q probably damaging Het
Wdr4 T A 17: 31,510,580 K95N probably damaging Het
Zfp141 T C 7: 42,477,196 N91S possibly damaging Het
Zfp383 C T 7: 29,915,270 R317* probably null Het
Other mutations in Slc12a6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01488:Slc12a6 APN 2 112353064 splice site probably null
IGL02573:Slc12a6 APN 2 112358641 critical splice donor site probably null
R0548:Slc12a6 UTSW 2 112335924 critical splice donor site probably null
R1495:Slc12a6 UTSW 2 112354190 missense probably damaging 0.99
R1726:Slc12a6 UTSW 2 112347426 missense probably damaging 1.00
R1856:Slc12a6 UTSW 2 112335927 splice site probably null
R1958:Slc12a6 UTSW 2 112355158 missense possibly damaging 0.92
R2112:Slc12a6 UTSW 2 112356485 missense probably damaging 1.00
R2865:Slc12a6 UTSW 2 112347317 missense probably benign 0.09
R3888:Slc12a6 UTSW 2 112267030 missense possibly damaging 0.76
R4412:Slc12a6 UTSW 2 112335888 missense possibly damaging 0.95
R4655:Slc12a6 UTSW 2 112357766 critical splice acceptor site probably null
R4669:Slc12a6 UTSW 2 112354295 missense probably damaging 1.00
R4928:Slc12a6 UTSW 2 112352961 missense probably damaging 1.00
R4974:Slc12a6 UTSW 2 112358525 missense probably damaging 1.00
R5016:Slc12a6 UTSW 2 112356627 intron probably benign
R5405:Slc12a6 UTSW 2 112339379 missense probably damaging 1.00
R5786:Slc12a6 UTSW 2 112284722 missense probably benign 0.01
R5836:Slc12a6 UTSW 2 112341998 missense possibly damaging 0.62
R6280:Slc12a6 UTSW 2 112337358 missense probably damaging 1.00
R6310:Slc12a6 UTSW 2 112335839 missense probably damaging 1.00
R6525:Slc12a6 UTSW 2 112352451 missense probably damaging 1.00
R6597:Slc12a6 UTSW 2 112352935 missense probably damaging 1.00
R6723:Slc12a6 UTSW 2 112337942 missense probably damaging 1.00
R6895:Slc12a6 UTSW 2 112355095 missense probably damaging 1.00
R7059:Slc12a6 UTSW 2 112352912 missense probably damaging 0.99
R7188:Slc12a6 UTSW 2 112334415 missense probably benign 0.04
R7395:Slc12a6 UTSW 2 112352542 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCATACCTTTCCTTAGGGTGAGTG -3'
(R):5'- AGCCTATGTTTGGTTACCTCTG -3'

Sequencing Primer
(F):5'- TGTAGAGTTTTAGTACAAGGCCCTC -3'
(R):5'- TGCCATCATCACTATTTTTAGATGAC -3'
Posted On2016-09-06