Incidental Mutation 'R5372:Hars2'
ID428832
Institutional Source Beutler Lab
Gene Symbol Hars2
Ensembl Gene ENSMUSG00000019143
Gene Namehistidyl-tRNA synthetase 2
SynonymsHarsl, HARSR, HO3
MMRRC Submission 042948-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.951) question?
Stock #R5372 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location36783008-36792562 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 36790481 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 361 (Y361H)
Ref Sequence ENSEMBL: ENSMUSP00000019287 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001419] [ENSMUST00000019287] [ENSMUST00000152954]
Predicted Effect probably benign
Transcript: ENSMUST00000001419
SMART Domains Protein: ENSMUSP00000001419
Gene: ENSMUSG00000001383

DomainStartEndE-ValueType
ZnF_U1 77 111 2.41e-11 SMART
ZnF_C2H2 80 104 5.48e0 SMART
coiled coil region 118 180 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000019287
AA Change: Y361H

PolyPhen 2 Score 0.931 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000019287
Gene: ENSMUSG00000019143
AA Change: Y361H

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:tRNA-synt_His 61 313 1.3e-23 PFAM
Pfam:tRNA-synt_2b 72 234 2.8e-21 PFAM
Pfam:HGTP_anticodon2 324 424 2.7e-8 PFAM
Pfam:HGTP_anticodon 329 420 2e-18 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124204
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131952
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134122
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145876
Predicted Effect possibly damaging
Transcript: ENSMUST00000152954
AA Change: Y442H

PolyPhen 2 Score 0.641 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000117231
Gene: ENSMUSG00000019143
AA Change: Y442H

DomainStartEndE-ValueType
signal peptide 1 27 N/A INTRINSIC
Pfam:tRNA-synt_His 61 389 1e-38 PFAM
Pfam:HGTP_anticodon 410 501 1.8e-16 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155842
Meta Mutation Damage Score 0.38 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (89/93)
MGI Phenotype FUNCTION: This gene encodes a putative member of the class II family of aminoacyl-tRNA synthetases. These enzymes play a critical role in protein biosynthesis by charging tRNAs with their cognate amino acids. This protein is encoded by the nuclear genome but is likely to be imported to the mitochondrion where it is thought to catalyze the ligation of histidine to tRNA molecules. Mutations in a similar gene in human have been associated with Perrault syndrome 2 (PRLTS2). [provided by RefSeq, Mar 2015]
Allele List at MGI
Other mutations in this stock
Total: 79 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca4 T A 3: 122,055,339 D108E probably damaging Het
Abhd12b A G 12: 70,181,026 D194G probably damaging Het
Adck5 A G 15: 76,594,507 probably benign Het
Adgrb3 C T 1: 25,128,859 V792I probably benign Het
Anxa8 G A 14: 34,093,911 V174M probably damaging Het
Apol9b A T 15: 77,735,720 R239W probably benign Het
Arhgap26 A G 18: 38,642,456 noncoding transcript Het
Atrnl1 A G 19: 57,755,536 Y1190C probably benign Het
Brinp3 T G 1: 146,831,726 L376R probably damaging Het
Btbd2 A T 10: 80,648,641 M132K probably damaging Het
C130073F10Rik A T 4: 101,890,487 I115K probably damaging Het
C1ra T A 6: 124,521,625 Y426N probably damaging Het
Cacna1b A T 2: 24,733,959 V203E probably damaging Het
Catsperg1 T A 7: 29,210,712 D68V probably benign Het
Ccdc158 A C 5: 92,632,560 S885A possibly damaging Het
Cdc42bpa T C 1: 180,064,979 V236A probably damaging Het
Cdca7 A T 2: 72,482,449 E176D probably damaging Het
Cdk17 A G 10: 93,226,039 D211G probably benign Het
Clca3a2 A C 3: 144,797,525 M888R probably benign Het
Clcn7 T A 17: 25,157,179 M568K possibly damaging Het
Clip1 G T 5: 123,630,240 N811K probably benign Het
Col12a1 T A 9: 79,678,366 Y1243F probably damaging Het
Dctn1 T A 6: 83,190,210 D315E probably damaging Het
Dgcr2 T C 16: 17,872,644 T41A probably benign Het
Dync2h1 G A 9: 7,176,962 probably benign Het
Ep300 A G 15: 81,636,830 I1264V unknown Het
Fam167b A T 4: 129,578,299 L26Q possibly damaging Het
Fam178b T A 1: 36,564,848 I457F possibly damaging Het
Fgd4 A T 16: 16,484,291 N133K probably benign Het
Fndc1 C G 17: 7,765,210 V1295L unknown Het
Gad2 A T 2: 22,690,243 D552V possibly damaging Het
Heca T A 10: 17,915,139 S390C probably damaging Het
Hephl1 G T 9: 15,097,899 Y132* probably null Het
Hormad1 T A 3: 95,576,424 D182E probably damaging Het
Ifna15 G A 4: 88,558,101 P49S probably damaging Het
Khsrp T C 17: 57,024,292 T429A possibly damaging Het
Magi2 A G 5: 20,702,110 Q1094R possibly damaging Het
Map3k11 T A 19: 5,690,962 I239K probably damaging Het
Mtus2 A G 5: 148,313,412 T1319A probably damaging Het
Nup54 A G 5: 92,417,857 I406T probably damaging Het
Nxpe2 T C 9: 48,339,519 T43A possibly damaging Het
Nynrin A G 14: 55,868,491 E889G probably benign Het
Olfr1313 A G 2: 112,072,109 I158T probably benign Het
Olfr160 T C 9: 37,711,938 M114V possibly damaging Het
Olfr301 T A 7: 86,412,968 I202N possibly damaging Het
Olfr663 A G 7: 104,703,795 D76G probably benign Het
Opa1 A C 16: 29,586,119 H45P probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Papola A G 12: 105,827,050 K543R probably benign Het
Plcxd3 G A 15: 4,574,788 V293I probably benign Het
Polr2g T C 19: 8,797,303 Y72C probably damaging Het
Ppp1r21 A G 17: 88,550,675 K205E probably benign Het
Ptpre A G 7: 135,653,940 K53E possibly damaging Het
Rasal3 T C 17: 32,391,344 K990E probably benign Het
Rgs3 A T 4: 62,652,697 probably benign Het
Rhd A G 4: 134,884,632 T254A possibly damaging Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Scube3 G T 17: 28,152,482 C57F probably damaging Het
Sh2d5 A G 4: 138,254,699 D57G possibly damaging Het
Slc12a6 T A 2: 112,347,360 L608* probably null Het
Slk A T 19: 47,625,393 N896I probably damaging Het
Smc6 A G 12: 11,282,430 D211G probably damaging Het
Sox6 A T 7: 115,550,151 Y371* probably null Het
Srcap G A 7: 127,557,613 probably null Het
Stard5 T A 7: 83,633,220 D80E probably damaging Het
Supv3l1 C T 10: 62,432,357 V570M probably damaging Het
Syt7 G T 19: 10,426,621 V180L probably damaging Het
Tacc2 T A 7: 130,623,260 H558Q probably benign Het
Tas2r120 T A 6: 132,657,483 M176K possibly damaging Het
Tmem135 A T 7: 89,165,174 probably null Het
Trim35 T C 14: 66,297,266 V66A possibly damaging Het
Tspan12 A G 6: 21,772,699 S284P probably benign Het
Ttll3 A T 6: 113,401,421 K257* probably null Het
Uggt1 C A 1: 36,244,060 probably benign Het
Vmn2r7 T A 3: 64,716,324 I283F probably damaging Het
Wdfy2 T G 14: 62,954,885 H363Q probably damaging Het
Wdr4 T A 17: 31,510,580 K95N probably damaging Het
Zfp141 T C 7: 42,477,196 N91S possibly damaging Het
Zfp383 C T 7: 29,915,270 R317* probably null Het
Other mutations in Hars2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00715:Hars2 APN 18 36785936 missense probably damaging 1.00
IGL00955:Hars2 APN 18 36789357 splice site probably benign
IGL01570:Hars2 APN 18 36787592 missense probably benign 0.04
IGL01618:Hars2 APN 18 36789577 nonsense probably null
IGL02165:Hars2 APN 18 36783394 start codon destroyed probably null 1.00
IGL02290:Hars2 APN 18 36785626 missense possibly damaging 0.56
IGL02685:Hars2 APN 18 36791118 missense probably benign 0.18
IGL02805:Hars2 APN 18 36787577 nonsense probably null
IGL02971:Hars2 APN 18 36786178 missense probably damaging 1.00
IGL03373:Hars2 APN 18 36785945 missense probably damaging 0.99
R0196:Hars2 UTSW 18 36789204 nonsense probably null
R0543:Hars2 UTSW 18 36789424 missense probably damaging 1.00
R0549:Hars2 UTSW 18 36786208 critical splice donor site probably null
R0557:Hars2 UTSW 18 36791077 missense possibly damaging 0.94
R0893:Hars2 UTSW 18 36787595 missense possibly damaging 0.56
R1188:Hars2 UTSW 18 36787969 missense probably damaging 0.99
R1289:Hars2 UTSW 18 36783412 unclassified probably null
R1381:Hars2 UTSW 18 36789217 missense possibly damaging 0.68
R2401:Hars2 UTSW 18 36789523 missense possibly damaging 0.95
R4119:Hars2 UTSW 18 36790488 missense probably damaging 0.98
R4351:Hars2 UTSW 18 36786178 missense probably damaging 1.00
R4404:Hars2 UTSW 18 36785936 missense probably damaging 1.00
R5629:Hars2 UTSW 18 36788666 nonsense probably null
R5886:Hars2 UTSW 18 36790097 intron probably benign
R7069:Hars2 UTSW 18 36787956 missense probably damaging 0.99
R7070:Hars2 UTSW 18 36791112 nonsense probably null
R7188:Hars2 UTSW 18 36790561 missense probably benign 0.08
Predicted Primers PCR Primer
(F):5'- ATGTCGGCACAGTGATCGTG -3'
(R):5'- ATACTAGTGTCTTAGCCAGTTCTTC -3'

Sequencing Primer
(F):5'- GCACAGTGATCGTGGCTCATTTC -3'
(R):5'- GGCATGACAATATATGCCTGTTGCC -3'
Posted On2016-09-06