Incidental Mutation 'R5373:Eif3m'
ID428847
Institutional Source Beutler Lab
Gene Symbol Eif3m
Ensembl Gene ENSMUSG00000027170
Gene Nameeukaryotic translation initiation factor 3, subunit M
SynonymsGa17, Pcid1, Tango7
MMRRC Submission 042949-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5373 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location104999656-105017080 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105012932 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 151 (I151N)
Ref Sequence ENSEMBL: ENSMUSP00000028592 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028592] [ENSMUST00000111110]
Predicted Effect probably damaging
Transcript: ENSMUST00000028592
AA Change: I151N

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000028592
Gene: ENSMUSG00000027170
AA Change: I151N

DomainStartEndE-ValueType
Blast:HDc 119 209 1e-12 BLAST
PINT 268 357 6.42e-26 SMART
low complexity region 358 372 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000111110
AA Change: I19N

PolyPhen 2 Score 0.623 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000106739
Gene: ENSMUSG00000027170
AA Change: I19N

DomainStartEndE-ValueType
Blast:HDc 13 77 7e-8 BLAST
PINT 136 225 6.42e-26 SMART
low complexity region 226 240 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130611
Predicted Effect probably benign
Transcript: ENSMUST00000144358
SMART Domains Protein: ENSMUSP00000114374
Gene: ENSMUSG00000045106

DomainStartEndE-ValueType
Pfam:CCDC73 1 182 3.1e-77 PFAM
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that is part of the eurkaryotic translation initiation factor 3 complete (eIF-3) required for protein synthesis. Elevated levels of the encoded protein are present in cancer cell lines. Inactivation of the encoded protein has been shown to interfere with translation of herpes virus mRNAs by preventing the association of mRNAs with the ribosomes. A pseudogene of this gene is located on the X chromosome. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a targeted allele exhibit embryonic lethality. Mice heterozygous for this allele exhibit decreased body weight and altered organ weights. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,635 S862G probably benign Het
2410089E03Rik T C 15: 8,270,803 V3198A unknown Het
Abcb5 G T 12: 118,887,177 T887K probably damaging Het
Adgrf1 G A 17: 43,291,005 probably benign Het
Adss T G 1: 177,796,388 I3L probably benign Het
Anapc7 T A 5: 122,438,217 D302E probably benign Het
Ank3 A G 10: 69,953,476 probably null Het
Arpp21 T G 9: 112,067,268 M687L probably benign Het
Camkv T C 9: 107,946,889 S221P probably benign Het
Ccdc88a C T 11: 29,463,409 T649M possibly damaging Het
Cdh12 A C 15: 21,583,912 S613R probably damaging Het
Chsy1 C T 7: 66,110,076 Q56* probably null Het
Cisd2 A G 3: 135,408,835 V125A probably benign Het
Cntnap2 T A 6: 47,107,969 H1121Q probably benign Het
Corin A T 5: 72,304,953 C876S probably damaging Het
Cspp1 T G 1: 10,134,126 L1038R probably damaging Het
Cwc15 A G 9: 14,504,938 K147E possibly damaging Het
Dlgap2 A G 8: 14,823,614 D739G probably benign Het
Dmxl2 A G 9: 54,369,189 probably benign Het
Dnajc6 T C 4: 101,615,627 I317T probably damaging Het
Dpysl3 T C 18: 43,361,036 Y193C probably damaging Het
Dtna T C 18: 23,651,613 Y730H probably damaging Het
Dusp3 A G 11: 101,984,625 Y38H possibly damaging Het
Eml2 A T 7: 19,179,263 D62V possibly damaging Het
Epb41l3 C A 17: 69,286,800 H810N probably damaging Het
Evc2 C T 5: 37,378,210 R410W probably damaging Het
Fam169b T C 7: 68,300,838 Y13H probably damaging Het
Fcrl5 A G 3: 87,446,391 T348A probably benign Het
Fezf2 A T 14: 12,344,803 V128E possibly damaging Het
Ighv3-5 A G 12: 114,262,953 S18P probably damaging Het
Kcnq5 T A 1: 21,961,571 H4L unknown Het
Kdm5d C T Y: 927,995 P756S probably benign Het
Lig1 AG A 7: 13,305,923 probably null Het
Ly75 A T 2: 60,311,771 L1332M possibly damaging Het
Med1 T A 11: 98,163,963 K378N probably damaging Het
Mn1 A G 5: 111,421,886 probably null Het
Mpo T C 11: 87,803,611 probably null Het
Mtfr2 G T 10: 20,352,852 C48F probably benign Het
Nt5c G A 11: 115,490,817 probably null Het
Pcdhga4 T C 18: 37,685,596 V66A probably damaging Het
Pik3c3 T C 18: 30,312,561 S534P probably benign Het
Pla2g4e A T 2: 120,186,395 C222S probably benign Het
Plch1 A C 3: 63,698,078 H1468Q probably benign Het
Psd2 T A 18: 36,007,503 W610R probably damaging Het
Ptgs1 A T 2: 36,251,186 K548N probably damaging Het
Ptpn14 T C 1: 189,850,963 M669T probably benign Het
Ptprf G T 4: 118,226,041 T923K possibly damaging Het
Ptprg A G 14: 12,213,665 N1011S probably benign Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Rgsl1 C T 1: 153,790,307 V986I probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rxfp2 A G 5: 150,070,260 T596A probably benign Het
Serpina3j A G 12: 104,314,727 D53G probably damaging Het
Slc26a7 A T 4: 14,546,447 I294N probably damaging Het
Slirp T C 12: 87,449,422 S96P possibly damaging Het
Snx6 T C 12: 54,770,728 E128G probably damaging Het
Spata6 T A 4: 111,822,834 probably null Het
Stap1 A G 5: 86,090,928 T152A possibly damaging Het
Susd5 G A 9: 114,082,585 G188R probably damaging Het
Thap2 A T 10: 115,372,839 Y125* probably null Het
Tnrc18 G A 5: 142,740,156 R1793C unknown Het
Ugt1a10 T A 1: 88,055,910 D143E probably damaging Het
Vmn1r85 A T 7: 13,084,328 Y296* probably null Het
Vmn2r71 C T 7: 85,618,542 T68I possibly damaging Het
Zc3h6 A T 2: 129,002,156 I207F possibly damaging Het
Zfp518a T C 19: 40,913,510 S628P probably benign Het
Zfp85 T C 13: 67,749,458 Y165C probably damaging Het
Zufsp T C 10: 33,927,466 N541D possibly damaging Het
Other mutations in Eif3m
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02003:Eif3m APN 2 105012843 intron probably benign
IGL02661:Eif3m APN 2 105004969 missense probably damaging 0.98
IGL02932:Eif3m APN 2 105014869 missense probably damaging 1.00
R0039:Eif3m UTSW 2 105005872 missense probably damaging 1.00
R0373:Eif3m UTSW 2 105005000 missense probably benign 0.06
R1452:Eif3m UTSW 2 105006777 missense probably damaging 1.00
R1695:Eif3m UTSW 2 105016953 missense probably damaging 0.98
R1934:Eif3m UTSW 2 105001279 missense probably damaging 1.00
R2115:Eif3m UTSW 2 105006796 missense probably damaging 1.00
R2416:Eif3m UTSW 2 105013833 missense probably benign
R4610:Eif3m UTSW 2 105013288 missense probably benign 0.08
R4713:Eif3m UTSW 2 105006839 unclassified probably null
R5374:Eif3m UTSW 2 105012932 missense probably damaging 0.99
R5725:Eif3m UTSW 2 105013841 missense probably damaging 0.97
Z1088:Eif3m UTSW 2 105013256 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATTTCTGATGCTGTGGAGAACAAG -3'
(R):5'- AACTCAGGTAGGAGCAGCTCTG -3'

Sequencing Primer
(F):5'- GAGAACAAGGTAAAAACAACTAGCTC -3'
(R):5'- TAGGAGCAGCTCTGTGTGCC -3'
Posted On2016-09-06