Incidental Mutation 'R5373:Mpo'
ID428882
Institutional Source Beutler Lab
Gene Symbol Mpo
Ensembl Gene ENSMUSG00000009350
Gene Namemyeloperoxidase
Synonyms
MMRRC Submission 042949-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R5373 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location87793581-87804413 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 87803611 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000112837 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020779] [ENSMUST00000103177] [ENSMUST00000107930] [ENSMUST00000121303] [ENSMUST00000121303] [ENSMUST00000146650]
Predicted Effect probably null
Transcript: ENSMUST00000020779
SMART Domains Protein: ENSMUSP00000020779
Gene: ENSMUSG00000009350

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:An_peroxidase 147 692 4.2e-183 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000103177
SMART Domains Protein: ENSMUSP00000099466
Gene: ENSMUSG00000009356

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:An_peroxidase 136 682 1.8e-180 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000107930
SMART Domains Protein: ENSMUSP00000103563
Gene: ENSMUSG00000009350

DomainStartEndE-ValueType
SCOP:g1cxp.1 82 99 1e-5 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121303
SMART Domains Protein: ENSMUSP00000112837
Gene: ENSMUSG00000009350

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:An_peroxidase 147 692 4.2e-183 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000121303
SMART Domains Protein: ENSMUSP00000112837
Gene: ENSMUSG00000009350

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:An_peroxidase 147 692 4.2e-183 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130442
Predicted Effect probably benign
Transcript: ENSMUST00000146650
SMART Domains Protein: ENSMUSP00000128484
Gene: ENSMUSG00000009350

DomainStartEndE-ValueType
Pfam:An_peroxidase 1 112 2.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167903
Meta Mutation Damage Score 0.62 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 95.2%
Validation Efficiency 96% (74/77)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Myeloperoxidase (MPO) is a heme protein synthesized during myeloid differentiation that constitutes the major component of neutrophil azurophilic granules. Produced as a single chain precursor, myeloperoxidase is subsequently cleaved into a light and heavy chain. The mature myeloperoxidase is a tetramer composed of 2 light chains and 2 heavy chains. This enzyme produces hypohalous acids central to the microbicidal activity of neutrophils. [provided by RefSeq, Nov 2014]
PHENOTYPE: Homozygous inactivation of this gene causes neutrophil dysfunction and decreased resistance to fungal infection with Candida, and may lead to enhanced atherosclerosis, reduced neutrophil-mediated lysis of muscle cells, decreased resistance to EAE, and altered asbestos-induced lung inflammation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 68 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1110002E22Rik A G 3: 138,067,635 S862G probably benign Het
2410089E03Rik T C 15: 8,270,803 V3198A unknown Het
Abcb5 G T 12: 118,887,177 T887K probably damaging Het
Adgrf1 G A 17: 43,291,005 probably benign Het
Adss T G 1: 177,796,388 I3L probably benign Het
Anapc7 T A 5: 122,438,217 D302E probably benign Het
Ank3 A G 10: 69,953,476 probably null Het
Arpp21 T G 9: 112,067,268 M687L probably benign Het
Camkv T C 9: 107,946,889 S221P probably benign Het
Ccdc88a C T 11: 29,463,409 T649M possibly damaging Het
Cdh12 A C 15: 21,583,912 S613R probably damaging Het
Chsy1 C T 7: 66,110,076 Q56* probably null Het
Cisd2 A G 3: 135,408,835 V125A probably benign Het
Cntnap2 T A 6: 47,107,969 H1121Q probably benign Het
Corin A T 5: 72,304,953 C876S probably damaging Het
Cspp1 T G 1: 10,134,126 L1038R probably damaging Het
Cwc15 A G 9: 14,504,938 K147E possibly damaging Het
Dlgap2 A G 8: 14,823,614 D739G probably benign Het
Dmxl2 A G 9: 54,369,189 probably benign Het
Dnajc6 T C 4: 101,615,627 I317T probably damaging Het
Dpysl3 T C 18: 43,361,036 Y193C probably damaging Het
Dtna T C 18: 23,651,613 Y730H probably damaging Het
Dusp3 A G 11: 101,984,625 Y38H possibly damaging Het
Eif3m A T 2: 105,012,932 I151N probably damaging Het
Eml2 A T 7: 19,179,263 D62V possibly damaging Het
Epb41l3 C A 17: 69,286,800 H810N probably damaging Het
Evc2 C T 5: 37,378,210 R410W probably damaging Het
Fam169b T C 7: 68,300,838 Y13H probably damaging Het
Fcrl5 A G 3: 87,446,391 T348A probably benign Het
Fezf2 A T 14: 12,344,803 V128E possibly damaging Het
Ighv3-5 A G 12: 114,262,953 S18P probably damaging Het
Kcnq5 T A 1: 21,961,571 H4L unknown Het
Kdm5d C T Y: 927,995 P756S probably benign Het
Lig1 AG A 7: 13,305,923 probably null Het
Ly75 A T 2: 60,311,771 L1332M possibly damaging Het
Med1 T A 11: 98,163,963 K378N probably damaging Het
Mn1 A G 5: 111,421,886 probably null Het
Mtfr2 G T 10: 20,352,852 C48F probably benign Het
Nt5c G A 11: 115,490,817 probably null Het
Pcdhga4 T C 18: 37,685,596 V66A probably damaging Het
Pik3c3 T C 18: 30,312,561 S534P probably benign Het
Pla2g4e A T 2: 120,186,395 C222S probably benign Het
Plch1 A C 3: 63,698,078 H1468Q probably benign Het
Psd2 T A 18: 36,007,503 W610R probably damaging Het
Ptgs1 A T 2: 36,251,186 K548N probably damaging Het
Ptpn14 T C 1: 189,850,963 M669T probably benign Het
Ptprf G T 4: 118,226,041 T923K possibly damaging Het
Ptprg A G 14: 12,213,665 N1011S probably benign Het
Ptprz1 T A 6: 23,007,355 V1639E probably damaging Het
Rgsl1 C T 1: 153,790,307 V986I probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Rxfp2 A G 5: 150,070,260 T596A probably benign Het
Serpina3j A G 12: 104,314,727 D53G probably damaging Het
Slc26a7 A T 4: 14,546,447 I294N probably damaging Het
Slirp T C 12: 87,449,422 S96P possibly damaging Het
Snx6 T C 12: 54,770,728 E128G probably damaging Het
Spata6 T A 4: 111,822,834 probably null Het
Stap1 A G 5: 86,090,928 T152A possibly damaging Het
Susd5 G A 9: 114,082,585 G188R probably damaging Het
Thap2 A T 10: 115,372,839 Y125* probably null Het
Tnrc18 G A 5: 142,740,156 R1793C unknown Het
Ugt1a10 T A 1: 88,055,910 D143E probably damaging Het
Vmn1r85 A T 7: 13,084,328 Y296* probably null Het
Vmn2r71 C T 7: 85,618,542 T68I possibly damaging Het
Zc3h6 A T 2: 129,002,156 I207F possibly damaging Het
Zfp518a T C 19: 40,913,510 S628P probably benign Het
Zfp85 T C 13: 67,749,458 Y165C probably damaging Het
Zufsp T C 10: 33,927,466 N541D possibly damaging Het
Other mutations in Mpo
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Mpo APN 11 87802617 missense probably benign
IGL00668:Mpo APN 11 87797334 missense probably benign 0.01
IGL01016:Mpo APN 11 87797610 unclassified probably null
IGL01517:Mpo APN 11 87795821 missense possibly damaging 0.83
IGL01530:Mpo APN 11 87801191 missense probably benign 0.00
IGL02123:Mpo APN 11 87794795 missense probably benign 0.05
R0091:Mpo UTSW 11 87801610 missense probably benign 0.06
R0458:Mpo UTSW 11 87796297 missense probably benign 0.35
R0506:Mpo UTSW 11 87803504 missense probably benign 0.00
R0574:Mpo UTSW 11 87796076 missense probably damaging 0.99
R0850:Mpo UTSW 11 87797502 missense probably damaging 1.00
R1488:Mpo UTSW 11 87797430 missense probably damaging 1.00
R1753:Mpo UTSW 11 87795881 missense probably benign 0.06
R1785:Mpo UTSW 11 87797361 missense possibly damaging 0.90
R1891:Mpo UTSW 11 87801280 nonsense probably null
R1989:Mpo UTSW 11 87803472 missense probably damaging 1.00
R2107:Mpo UTSW 11 87796075 missense probably damaging 1.00
R2108:Mpo UTSW 11 87796075 missense probably damaging 1.00
R2130:Mpo UTSW 11 87797361 missense possibly damaging 0.90
R2132:Mpo UTSW 11 87797361 missense possibly damaging 0.90
R3930:Mpo UTSW 11 87801040 missense probably damaging 1.00
R3931:Mpo UTSW 11 87801040 missense probably damaging 1.00
R3941:Mpo UTSW 11 87797349 missense probably benign 0.02
R4323:Mpo UTSW 11 87796039 missense probably damaging 1.00
R4857:Mpo UTSW 11 87796281 missense probably benign
R4892:Mpo UTSW 11 87802681 missense probably benign 0.00
R5224:Mpo UTSW 11 87796457 unclassified probably benign
R5250:Mpo UTSW 11 87803433 missense probably benign 0.03
R5374:Mpo UTSW 11 87803611 critical splice donor site probably null
R5408:Mpo UTSW 11 87801025 splice site probably null
R5708:Mpo UTSW 11 87801755 splice site probably null
R6354:Mpo UTSW 11 87797346 missense possibly damaging 0.89
R6598:Mpo UTSW 11 87799972 missense probably benign 0.43
R6713:Mpo UTSW 11 87795368 missense probably damaging 1.00
R7053:Mpo UTSW 11 87803510 missense probably damaging 0.99
R7395:Mpo UTSW 11 87801124 missense probably damaging 1.00
Z1088:Mpo UTSW 11 87795245 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- TAAACAGCAGAGACAGGCCTTG -3'
(R):5'- ATTGCCCATGCTCACAGACC -3'

Sequencing Primer
(F):5'- AGAGACAGGCCTTGGCCAG -3'
(R):5'- TATAGATGTGCACAAGTGTATATGC -3'
Posted On2016-09-06