Incidental Mutation 'R5375:Dclre1b'
ID428996
Institutional Source Beutler Lab
Gene Symbol Dclre1b
Ensembl Gene ENSMUSG00000027845
Gene NameDNA cross-link repair 1B
SynonymsSNMIB, Apollo, mSNM1B
MMRRC Submission 042951-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5375 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location103800605-103809444 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103803974 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 207 (R207H)
Ref Sequence ENSEMBL: ENSMUSP00000102447 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029435] [ENSMUST00000063502] [ENSMUST00000106832] [ENSMUST00000106834] [ENSMUST00000128716] [ENSMUST00000198752]
Predicted Effect probably damaging
Transcript: ENSMUST00000029435
AA Change: R207H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029435
Gene: ENSMUSG00000027845
AA Change: R207H

DomainStartEndE-ValueType
Lactamase_B 1 175 2.06e0 SMART
Pfam:DRMBL 215 301 1e-13 PFAM
PDB:3BUA|H 492 526 1e-10 PDB
Predicted Effect probably damaging
Transcript: ENSMUST00000063502
AA Change: R81H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000067695
Gene: ENSMUSG00000027845
AA Change: R81H

DomainStartEndE-ValueType
Blast:Lactamase_B 1 49 4e-24 BLAST
Pfam:DRMBL 89 176 7.4e-20 PFAM
PDB:3BUA|H 366 400 8e-11 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000106832
SMART Domains Protein: ENSMUSP00000102445
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Lactamase_B 1 175 2.06e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106834
AA Change: R207H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102447
Gene: ENSMUSG00000027845
AA Change: R207H

DomainStartEndE-ValueType
Lactamase_B 1 175 2.06e0 SMART
Pfam:DRMBL 215 302 7.9e-20 PFAM
PDB:3BUA|H 492 526 1e-10 PDB
Predicted Effect probably benign
Transcript: ENSMUST00000128716
SMART Domains Protein: ENSMUSP00000121063
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Blast:Lactamase_B 1 63 3e-40 BLAST
PDB:3ZDK|A 1 63 3e-34 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145893
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149374
Predicted Effect probably benign
Transcript: ENSMUST00000198752
SMART Domains Protein: ENSMUSP00000143067
Gene: ENSMUSG00000027845

DomainStartEndE-ValueType
Blast:Lactamase_B 1 93 2e-64 BLAST
PDB:3ZDK|A 1 97 1e-62 PDB
SCOP:d1a7ta_ 3 93 5e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198835
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA interstrand cross-links prevent strand separation, thereby physically blocking transcription, replication, and segregation of DNA. DCLRE1B is one of several evolutionarily conserved genes involved in repair of interstrand cross-links (Dronkert et al., 2000 [PubMed 10848582]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit reduced embryo size and neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy3 T A 12: 4,210,870 N995K probably damaging Het
AI314180 T A 4: 58,809,401 K1658* probably null Het
Aldh4a1 T C 4: 139,633,922 M60T probably benign Het
Alpk2 A T 18: 65,372,738 H70Q probably damaging Het
Babam2 T A 5: 31,701,863 I5N possibly damaging Het
Blm T C 7: 80,513,229 T125A probably benign Het
Bloc1s1 T C 10: 128,923,957 probably benign Het
Calcr G T 6: 3,714,651 Q160K probably benign Het
Ccdc43 C T 11: 102,690,232 A131T probably damaging Het
Cdh15 A T 8: 122,865,100 N575Y probably damaging Het
Chd8 T C 14: 52,204,154 D827G probably damaging Het
Col3a1 A G 1: 45,347,899 probably null Het
Creb5 A T 6: 53,681,017 M255L possibly damaging Het
Cst8 A G 2: 148,804,583 I78V probably benign Het
Cyld A G 8: 88,733,036 E440G possibly damaging Het
Cyp2b9 A C 7: 26,187,742 D192A probably damaging Het
Dnah6 A T 6: 73,123,855 F1936L probably damaging Het
Dpp9 A C 17: 56,189,424 Y761* probably null Het
Drc1 A T 5: 30,356,401 M434L probably benign Het
Dtx3l A T 16: 35,933,027 I403N probably damaging Het
Efcab9 A G 11: 32,527,484 Y13H probably damaging Het
Efhb T A 17: 53,401,626 N672I possibly damaging Het
Eif5b T C 1: 38,045,754 V894A possibly damaging Het
Elovl3 T C 19: 46,134,696 F237S probably benign Het
Emc1 T A 4: 139,366,491 D637E probably damaging Het
Erbb2 C A 11: 98,433,412 P742Q probably damaging Het
Fam234b C A 6: 135,233,357 L584M probably damaging Het
Fancd2 A T 6: 113,568,712 D14V possibly damaging Het
Fat2 T C 11: 55,262,820 H3522R probably benign Het
Fgfr2 T C 7: 130,241,215 N147D possibly damaging Het
Gm26657 A G 4: 56,741,180 probably benign Het
Hcrtr1 C T 4: 130,135,725 V188M probably benign Het
Herc1 T C 9: 66,467,887 V3331A probably damaging Het
Hmcn2 T C 2: 31,430,441 V3978A possibly damaging Het
Invs G A 4: 48,385,262 R202K probably benign Het
Lgr5 C T 10: 115,478,564 S156N probably benign Het
Mras T G 9: 99,394,616 D67A probably damaging Het
Mrpl39 A G 16: 84,723,902 L283P probably damaging Het
Ncoa6 A T 2: 155,433,995 I110N probably benign Het
Neb T C 2: 52,212,584 D544G possibly damaging Het
Nlrc3 A G 16: 3,964,753 I264T possibly damaging Het
Olfr180 T C 16: 58,915,885 Y252C possibly damaging Het
Olfr341 A G 2: 36,479,297 Y278H probably damaging Het
Olfr714 T A 7: 107,073,873 M15K probably benign Het
Olfr830 A G 9: 18,876,146 K273R probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Phf11d T C 14: 59,352,671 D234G probably null Het
Polq A T 16: 37,082,784 D1980V probably damaging Het
Rasa1 A T 13: 85,288,903 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec23a A G 12: 59,007,005 V69A probably benign Het
Sipa1 A G 19: 5,659,612 I260T probably damaging Het
Smarcc1 T A 9: 110,190,949 L628H probably damaging Het
Snx31 A G 15: 36,525,584 V323A probably damaging Het
Sun2 A G 15: 79,727,522 S565P probably damaging Het
Tmem74 C T 15: 43,867,168 D160N possibly damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Trp53inp1 A G 4: 11,165,305 T110A probably benign Het
Ttll9 G T 2: 152,984,224 C118F probably benign Het
Vps4b A G 1: 106,791,692 L42P probably benign Het
Xirp2 A T 2: 67,511,906 N1497I probably damaging Het
Xpo4 A G 14: 57,638,307 V123A probably damaging Het
Zfhx4 A T 3: 5,412,425 T3367S probably damaging Het
Zfp236 T C 18: 82,597,688 E1782G possibly damaging Het
Zfp35 T A 18: 24,002,916 C106S possibly damaging Het
Zfpm1 A G 8: 122,336,073 T624A probably benign Het
Zmiz2 C T 11: 6,397,519 Q276* probably null Het
Other mutations in Dclre1b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01330:Dclre1b APN 3 103803126 missense probably benign
IGL01411:Dclre1b APN 3 103803323 missense probably damaging 1.00
IGL02311:Dclre1b APN 3 103808093 missense probably damaging 1.00
IGL03250:Dclre1b APN 3 103804064 unclassified probably null
IGL03410:Dclre1b APN 3 103808140 missense probably damaging 1.00
IGL03046:Dclre1b UTSW 3 103803281 missense probably benign 0.00
R0022:Dclre1b UTSW 3 103803148 missense probably benign 0.03
R0022:Dclre1b UTSW 3 103803148 missense probably benign 0.03
R1173:Dclre1b UTSW 3 103803876 missense probably benign 0.00
R1997:Dclre1b UTSW 3 103803356 missense probably benign 0.02
R2051:Dclre1b UTSW 3 103809040 missense possibly damaging 0.68
R2914:Dclre1b UTSW 3 103808114 missense probably damaging 0.98
R3420:Dclre1b UTSW 3 103808096 missense probably damaging 1.00
R4247:Dclre1b UTSW 3 103804084 intron probably null
R4250:Dclre1b UTSW 3 103804084 intron probably null
R4474:Dclre1b UTSW 3 103807243 unclassified probably benign
R4866:Dclre1b UTSW 3 103808096 missense probably damaging 0.99
R5098:Dclre1b UTSW 3 103809136 unclassified probably benign
R5796:Dclre1b UTSW 3 103807457 nonsense probably null
R5888:Dclre1b UTSW 3 103803737 missense probably damaging 1.00
R6189:Dclre1b UTSW 3 103803533 missense probably damaging 1.00
R6356:Dclre1b UTSW 3 103808155 missense probably damaging 1.00
R6443:Dclre1b UTSW 3 103803188 missense possibly damaging 0.82
R7471:Dclre1b UTSW 3 103803114 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTCGGAGTAAGATGAATGGTC -3'
(R):5'- CACCATACAGGCATCTGCTG -3'

Sequencing Primer
(F):5'- TGAATGGTCAGAGTACGGGAC -3'
(R):5'- ACCATACAGGCATCTGCTGTATATC -3'
Posted On2016-09-06