Incidental Mutation 'R5375:Fgfr2'
ID429014
Institutional Source Beutler Lab
Gene Symbol Fgfr2
Ensembl Gene ENSMUSG00000030849
Gene Namefibroblast growth factor receptor 2
SynonymsFgfr-2, KGFRTr, Bek, Fgfr7, Fgfr-7, svs
MMRRC Submission 042951-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R5375 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location130162451-133123350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130241215 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 147 (N147D)
Ref Sequence ENSEMBL: ENSMUSP00000113474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000117073] [ENSMUST00000117089] [ENSMUST00000117357] [ENSMUST00000117691] [ENSMUST00000117754] [ENSMUST00000117858] [ENSMUST00000117872] [ENSMUST00000118296] [ENSMUST00000119260] [ENSMUST00000120141] [ENSMUST00000120187] [ENSMUST00000120715] [ENSMUST00000121064] [ENSMUST00000121080] [ENSMUST00000122054] [ENSMUST00000122448] [ENSMUST00000124096] [ENSMUST00000153166]
Predicted Effect probably benign
Transcript: ENSMUST00000117073
SMART Domains Protein: ENSMUSP00000112672
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 55 123 4.66e-13 SMART
IGc2 154 234 7.41e-7 SMART
transmembrane domain 260 282 N/A INTRINSIC
low complexity region 314 323 N/A INTRINSIC
TyrKc 364 640 4.38e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117089
AA Change: N147D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112992
Gene: ENSMUSG00000030849
AA Change: N147D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
IGc2 269 347 1.9e-4 SMART
transmembrane domain 376 398 N/A INTRINSIC
low complexity region 430 439 N/A INTRINSIC
TyrKc 480 756 4.38e-152 SMART
low complexity region 784 798 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117357
SMART Domains Protein: ENSMUSP00000112580
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 55 123 4.66e-13 SMART
IGc2 154 232 1.9e-4 SMART
transmembrane domain 261 283 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
TyrKc 365 641 4.38e-152 SMART
low complexity region 669 683 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117691
AA Change: N147D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000113180
Gene: ENSMUSG00000030849
AA Change: N147D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
IGc2 269 347 1.9e-4 SMART
transmembrane domain 376 398 N/A INTRINSIC
low complexity region 432 441 N/A INTRINSIC
TyrKc 482 758 4.38e-152 SMART
low complexity region 786 800 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117754
SMART Domains Protein: ENSMUSP00000113187
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 56 136 7.41e-7 SMART
transmembrane domain 162 184 N/A INTRINSIC
low complexity region 218 227 N/A INTRINSIC
TyrKc 268 544 4.38e-152 SMART
low complexity region 572 586 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000117858
AA Change: N147D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112623
Gene: ENSMUSG00000030849
AA Change: N147D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
IGc2 269 347 1.9e-4 SMART
transmembrane domain 376 398 N/A INTRINSIC
low complexity region 432 441 N/A INTRINSIC
TyrKc 482 758 4.38e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000117872
SMART Domains Protein: ENSMUSP00000113994
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
IGc2 74 142 4.66e-13 SMART
IGc2 173 253 7.41e-7 SMART
transmembrane domain 279 301 N/A INTRINSIC
low complexity region 333 342 N/A INTRINSIC
TyrKc 383 659 4.38e-152 SMART
low complexity region 687 701 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000118296
AA Change: N58D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000112471
Gene: ENSMUSG00000030849
AA Change: N58D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 36 57 N/A INTRINSIC
IGc2 81 149 4.66e-13 SMART
IGc2 180 258 1.9e-4 SMART
transmembrane domain 287 309 N/A INTRINSIC
low complexity region 343 352 N/A INTRINSIC
TyrKc 393 669 4.38e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000119260
AA Change: N147D

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000113010
Gene: ENSMUSG00000030849
AA Change: N147D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
IGc2 269 349 7.41e-7 SMART
transmembrane domain 375 397 N/A INTRINSIC
low complexity region 429 438 N/A INTRINSIC
TyrKc 479 755 4.38e-152 SMART
low complexity region 783 797 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120141
AA Change: N58D

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000113415
Gene: ENSMUSG00000030849
AA Change: N58D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 36 57 N/A INTRINSIC
IGc2 81 149 4.66e-13 SMART
IGc2 180 258 1.9e-4 SMART
transmembrane domain 287 309 N/A INTRINSIC
low complexity region 341 350 N/A INTRINSIC
TyrKc 391 667 4.38e-152 SMART
low complexity region 695 709 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120187
SMART Domains Protein: ENSMUSP00000113248
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
IGc2 74 142 4.66e-13 SMART
IGc2 173 251 1.9e-4 SMART
transmembrane domain 280 302 N/A INTRINSIC
low complexity region 336 345 N/A INTRINSIC
TyrKc 386 662 4.38e-152 SMART
low complexity region 690 704 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000120715
AA Change: N147D

PolyPhen 2 Score 0.647 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000113474
Gene: ENSMUSG00000030849
AA Change: N147D

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
low complexity region 31 40 N/A INTRINSIC
IGc2 53 114 6.59e-13 SMART
low complexity region 129 146 N/A INTRINSIC
IGc2 170 238 4.66e-13 SMART
transmembrane domain 263 285 N/A INTRINSIC
low complexity region 319 328 N/A INTRINSIC
TyrKc 369 645 4.38e-152 SMART
low complexity region 673 687 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121064
SMART Domains Protein: ENSMUSP00000113452
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 56 134 1.9e-4 SMART
transmembrane domain 163 185 N/A INTRINSIC
low complexity region 219 228 N/A INTRINSIC
TyrKc 269 545 4.38e-152 SMART
low complexity region 573 587 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000121080
SMART Domains Protein: ENSMUSP00000112585
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 55 123 4.66e-13 SMART
IGc2 154 232 1.9e-4 SMART
transmembrane domain 261 283 N/A INTRINSIC
low complexity region 317 326 N/A INTRINSIC
TyrKc 367 643 4.38e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122054
AA Change: N166D

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000112430
Gene: ENSMUSG00000030849
AA Change: N166D

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
low complexity region 50 59 N/A INTRINSIC
IGc2 72 133 6.59e-13 SMART
low complexity region 148 165 N/A INTRINSIC
IGc2 189 257 4.66e-13 SMART
IGc2 288 368 7.41e-7 SMART
transmembrane domain 394 416 N/A INTRINSIC
low complexity region 450 459 N/A INTRINSIC
TyrKc 500 776 4.38e-152 SMART
low complexity region 804 818 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000122448
SMART Domains Protein: ENSMUSP00000113993
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
IGc2 55 123 4.66e-13 SMART
IGc2 154 232 1.9e-4 SMART
transmembrane domain 261 283 N/A INTRINSIC
low complexity region 315 324 N/A INTRINSIC
TyrKc 365 641 4.38e-152 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124096
SMART Domains Protein: ENSMUSP00000130971
Gene: ENSMUSG00000030849

DomainStartEndE-ValueType
Pfam:Pkinase 1 118 4.8e-19 PFAM
Pfam:Pkinase_Tyr 1 118 1.7e-50 PFAM
low complexity region 146 160 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129103
Predicted Effect probably benign
Transcript: ENSMUST00000153166
AA Change: N166D

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000120100
Gene: ENSMUSG00000030849
AA Change: N166D

DomainStartEndE-ValueType
transmembrane domain 21 40 N/A INTRINSIC
low complexity region 50 59 N/A INTRINSIC
IGc2 72 133 6.59e-13 SMART
low complexity region 148 165 N/A INTRINSIC
IGc2 189 257 4.66e-13 SMART
SCOP:d1ev2e1 269 311 1e-5 SMART
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the fibroblast growth factor receptor family, where amino acid sequence is highly conserved between members and throughout evolution. FGFR family members differ from one another in their ligand affinities and tissue distribution. A full-length representative protein consists of an extracellular region, composed of three immunoglobulin-like domains, a single hydrophobic membrane-spanning segment and a cytoplasmic tyrosine kinase domain. The extracellular portion of the protein interacts with fibroblast growth factors, setting in motion a cascade of downstream signals, ultimately influencing mitogenesis and differentiation. This particular family member is a high-affinity receptor for acidic, basic and/or keratinocyte growth factor, depending on the isoform. Mutations in this gene are associated with Crouzon syndrome, Pfeiffer syndrome, Craniosynostosis, Apert syndrome, Jackson-Weiss syndrome, Beare-Stevenson cutis gyrata syndrome, Saethre-Chotzen syndrome, and syndromic craniosynostosis. Multiple alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Jan 2009]
PHENOTYPE: Mice homozygous for null mutations die as embryos. Isoform IIIb deficient mutants die at birth with defects in multiple organs and tissues. Isoform IIIc deficient mutants have defects in osteoblast and chondrocyte lineages, producing dwarfism. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy3 T A 12: 4,210,870 N995K probably damaging Het
AI314180 T A 4: 58,809,401 K1658* probably null Het
Aldh4a1 T C 4: 139,633,922 M60T probably benign Het
Alpk2 A T 18: 65,372,738 H70Q probably damaging Het
Babam2 T A 5: 31,701,863 I5N possibly damaging Het
Blm T C 7: 80,513,229 T125A probably benign Het
Bloc1s1 T C 10: 128,923,957 probably benign Het
Calcr G T 6: 3,714,651 Q160K probably benign Het
Ccdc43 C T 11: 102,690,232 A131T probably damaging Het
Cdh15 A T 8: 122,865,100 N575Y probably damaging Het
Chd8 T C 14: 52,204,154 D827G probably damaging Het
Col3a1 A G 1: 45,347,899 probably null Het
Creb5 A T 6: 53,681,017 M255L possibly damaging Het
Cst8 A G 2: 148,804,583 I78V probably benign Het
Cyld A G 8: 88,733,036 E440G possibly damaging Het
Cyp2b9 A C 7: 26,187,742 D192A probably damaging Het
Dclre1b C T 3: 103,803,974 R207H probably damaging Het
Dnah6 A T 6: 73,123,855 F1936L probably damaging Het
Dpp9 A C 17: 56,189,424 Y761* probably null Het
Drc1 A T 5: 30,356,401 M434L probably benign Het
Dtx3l A T 16: 35,933,027 I403N probably damaging Het
Efcab9 A G 11: 32,527,484 Y13H probably damaging Het
Efhb T A 17: 53,401,626 N672I possibly damaging Het
Eif5b T C 1: 38,045,754 V894A possibly damaging Het
Elovl3 T C 19: 46,134,696 F237S probably benign Het
Emc1 T A 4: 139,366,491 D637E probably damaging Het
Erbb2 C A 11: 98,433,412 P742Q probably damaging Het
Fam234b C A 6: 135,233,357 L584M probably damaging Het
Fancd2 A T 6: 113,568,712 D14V possibly damaging Het
Fat2 T C 11: 55,262,820 H3522R probably benign Het
Gm26657 A G 4: 56,741,180 probably benign Het
Hcrtr1 C T 4: 130,135,725 V188M probably benign Het
Herc1 T C 9: 66,467,887 V3331A probably damaging Het
Hmcn2 T C 2: 31,430,441 V3978A possibly damaging Het
Invs G A 4: 48,385,262 R202K probably benign Het
Lgr5 C T 10: 115,478,564 S156N probably benign Het
Mras T G 9: 99,394,616 D67A probably damaging Het
Mrpl39 A G 16: 84,723,902 L283P probably damaging Het
Ncoa6 A T 2: 155,433,995 I110N probably benign Het
Neb T C 2: 52,212,584 D544G possibly damaging Het
Nlrc3 A G 16: 3,964,753 I264T possibly damaging Het
Olfr180 T C 16: 58,915,885 Y252C possibly damaging Het
Olfr341 A G 2: 36,479,297 Y278H probably damaging Het
Olfr714 T A 7: 107,073,873 M15K probably benign Het
Olfr830 A G 9: 18,876,146 K273R probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Phf11d T C 14: 59,352,671 D234G probably null Het
Polq A T 16: 37,082,784 D1980V probably damaging Het
Rasa1 A T 13: 85,288,903 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec23a A G 12: 59,007,005 V69A probably benign Het
Sipa1 A G 19: 5,659,612 I260T probably damaging Het
Smarcc1 T A 9: 110,190,949 L628H probably damaging Het
Snx31 A G 15: 36,525,584 V323A probably damaging Het
Sun2 A G 15: 79,727,522 S565P probably damaging Het
Tmem74 C T 15: 43,867,168 D160N possibly damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Trp53inp1 A G 4: 11,165,305 T110A probably benign Het
Ttll9 G T 2: 152,984,224 C118F probably benign Het
Vps4b A G 1: 106,791,692 L42P probably benign Het
Xirp2 A T 2: 67,511,906 N1497I probably damaging Het
Xpo4 A G 14: 57,638,307 V123A probably damaging Het
Zfhx4 A T 3: 5,412,425 T3367S probably damaging Het
Zfp236 T C 18: 82,597,688 E1782G possibly damaging Het
Zfp35 T A 18: 24,002,916 C106S possibly damaging Het
Zfpm1 A G 8: 122,336,073 T624A probably benign Het
Zmiz2 C T 11: 6,397,519 Q276* probably null Het
Other mutations in Fgfr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Fgfr2 APN 7 130167711 missense probably benign 0.45
IGL00594:Fgfr2 APN 7 130228723 missense probably damaging 1.00
IGL00963:Fgfr2 APN 7 130228761 missense probably damaging 0.99
IGL01968:Fgfr2 APN 7 130185248 missense probably damaging 1.00
IGL02003:Fgfr2 APN 7 130219072 missense probably damaging 1.00
IGL02063:Fgfr2 APN 7 130167755 missense probably damaging 1.00
IGL02239:Fgfr2 APN 7 130177686 missense probably damaging 1.00
IGL02349:Fgfr2 APN 7 130242606 missense probably damaging 1.00
IGL02630:Fgfr2 APN 7 130228795 splice site probably null
IGL02639:Fgfr2 APN 7 130228802 splice site probably benign
IGL03058:Fgfr2 APN 7 130182692 missense probably damaging 1.00
IGL03263:Fgfr2 APN 7 130180419 missense probably benign 0.12
IGL03377:Fgfr2 APN 7 130198517 missense probably damaging 0.98
R0048:Fgfr2 UTSW 7 130180488 splice site probably benign
R0048:Fgfr2 UTSW 7 130180488 splice site probably benign
R0078:Fgfr2 UTSW 7 130201075 missense possibly damaging 0.95
R0085:Fgfr2 UTSW 7 130196263 missense probably damaging 0.99
R0278:Fgfr2 UTSW 7 130261862 unclassified probably null
R0335:Fgfr2 UTSW 7 130196249 missense probably benign 0.00
R0557:Fgfr2 UTSW 7 130219081 missense probably damaging 1.00
R0631:Fgfr2 UTSW 7 130227239 intron probably benign
R0637:Fgfr2 UTSW 7 130171624 missense possibly damaging 0.89
R0841:Fgfr2 UTSW 7 130261905 missense probably benign 0.03
R0841:Fgfr2 UTSW 7 130772007 unclassified probably benign
R1646:Fgfr2 UTSW 7 130242644 missense probably damaging 1.00
R1670:Fgfr2 UTSW 7 130180457 missense probably damaging 1.00
R1678:Fgfr2 UTSW 7 130228620 splice site probably null
R1950:Fgfr2 UTSW 7 130198481 missense probably damaging 0.96
R2393:Fgfr2 UTSW 7 130227238 intron probably null
R3706:Fgfr2 UTSW 7 130198431 missense probably benign 0.31
R3717:Fgfr2 UTSW 7 130182757 missense probably damaging 1.00
R3808:Fgfr2 UTSW 7 130199848 missense probably benign 0.01
R3945:Fgfr2 UTSW 7 130177755 missense possibly damaging 0.71
R4438:Fgfr2 UTSW 7 130172930 nonsense probably null
R4718:Fgfr2 UTSW 7 130261788 missense probably damaging 1.00
R4779:Fgfr2 UTSW 7 130185193 intron probably benign
R4925:Fgfr2 UTSW 7 130185272 missense probably damaging 1.00
R4932:Fgfr2 UTSW 7 130241277 missense probably damaging 1.00
R4941:Fgfr2 UTSW 7 130198445 missense probably benign 0.21
R4980:Fgfr2 UTSW 7 130201080 missense probably damaging 1.00
R5304:Fgfr2 UTSW 7 130167774 missense probably damaging 1.00
R5313:Fgfr2 UTSW 7 130241240 missense probably benign 0.01
R5652:Fgfr2 UTSW 7 130261863 missense probably damaging 1.00
R6120:Fgfr2 UTSW 7 130228690 missense probably benign 0.24
R6347:Fgfr2 UTSW 7 130261757 missense probably damaging 1.00
R6375:Fgfr2 UTSW 7 130167745 missense probably damaging 1.00
R6475:Fgfr2 UTSW 7 130201120 missense probably benign 0.03
R6481:Fgfr2 UTSW 7 130185278 missense possibly damaging 0.85
R6494:Fgfr2 UTSW 7 130198550 missense probably damaging 1.00
R6542:Fgfr2 UTSW 7 130201123 missense probably benign 0.02
X0024:Fgfr2 UTSW 7 130185329 missense probably damaging 0.99
Z1088:Fgfr2 UTSW 7 130169799 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTGGACAGCAACAGTTTATTTGC -3'
(R):5'- TGGTAGACGGACACTTCCTG -3'

Sequencing Primer
(F):5'- CAGCAACAGTTTATTTGCAAGTTGG -3'
(R):5'- GTAGACGGACACTTCCTGACACTG -3'
Posted On2016-09-06