Incidental Mutation 'R5375:Adcy3'
ID429031
Institutional Source Beutler Lab
Gene Symbol Adcy3
Ensembl Gene ENSMUSG00000020654
Gene Nameadenylate cyclase 3
SynonymsAC3
MMRRC Submission 042951-MU
Accession Numbers

Ncbi RefSeq: NM_138305.3, NM_001159536.1, NM_001159537.1; MGI:99675

Is this an essential gene? Probably essential (E-score: 0.821) question?
Stock #R5375 (G1)
Quality Score225
Status Not validated
Chromosome12
Chromosomal Location4133103-4213525 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4210870 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Lysine at position 995 (N995K)
Ref Sequence ENSEMBL: ENSMUSP00000115406 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020981] [ENSMUST00000020984] [ENSMUST00000111169] [ENSMUST00000124505] [ENSMUST00000127756] [ENSMUST00000128466] [ENSMUST00000140975] [ENSMUST00000152065]
Predicted Effect probably benign
Transcript: ENSMUST00000020981
SMART Domains Protein: ENSMUSP00000020981
Gene: ENSMUSG00000020652

DomainStartEndE-ValueType
Pfam:CENP-O 1 74 2.1e-17 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000020984
AA Change: N995K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000020984
Gene: ENSMUSG00000020654
AA Change: N995K

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 105 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 170 187 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 226 245 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 841 858 N/A INTRINSIC
CYCc 884 1103 2.02e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000111169
SMART Domains Protein: ENSMUSP00000106799
Gene: ENSMUSG00000020652

DomainStartEndE-ValueType
coiled coil region 39 74 N/A INTRINSIC
Pfam:CENP-O 118 195 2.1e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000124505
AA Change: N994K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000122073
Gene: ENSMUSG00000020654
AA Change: N994K

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 105 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 170 187 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 226 245 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 840 857 N/A INTRINSIC
CYCc 883 1102 2.02e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126017
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127110
Predicted Effect probably damaging
Transcript: ENSMUST00000127756
AA Change: N995K

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000115406
Gene: ENSMUSG00000020654
AA Change: N995K

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
low complexity region 78 88 N/A INTRINSIC
low complexity region 183 197 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 841 858 N/A INTRINSIC
CYCc 884 1103 2.02e-70 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000128466
SMART Domains Protein: ENSMUSP00000121258
Gene: ENSMUSG00000020652

DomainStartEndE-ValueType
coiled coil region 40 75 N/A INTRINSIC
Pfam:CENP-O 119 196 7.1e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140975
SMART Domains Protein: ENSMUSP00000119136
Gene: ENSMUSG00000020652

DomainStartEndE-ValueType
coiled coil region 39 74 N/A INTRINSIC
Pfam:CENP-O 117 231 9.4e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000146261
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146523
Predicted Effect probably damaging
Transcript: ENSMUST00000152065
AA Change: N994K

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000115644
Gene: ENSMUSG00000020654
AA Change: N994K

DomainStartEndE-ValueType
low complexity region 11 21 N/A INTRINSIC
transmembrane domain 78 100 N/A INTRINSIC
transmembrane domain 105 125 N/A INTRINSIC
transmembrane domain 138 160 N/A INTRINSIC
transmembrane domain 170 187 N/A INTRINSIC
transmembrane domain 189 211 N/A INTRINSIC
transmembrane domain 226 245 N/A INTRINSIC
CYCc 270 472 2.17e-61 SMART
low complexity region 516 526 N/A INTRINSIC
low complexity region 535 554 N/A INTRINSIC
coiled coil region 567 600 N/A INTRINSIC
transmembrane domain 631 650 N/A INTRINSIC
transmembrane domain 660 682 N/A INTRINSIC
transmembrane domain 710 732 N/A INTRINSIC
transmembrane domain 752 771 N/A INTRINSIC
transmembrane domain 776 798 N/A INTRINSIC
transmembrane domain 840 857 N/A INTRINSIC
CYCc 883 1102 2.02e-70 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000152792
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.7%
  • 10x: 97.3%
  • 20x: 95.4%
Validation Efficiency
MGI Phenotype Strain: 2661086; 3604495
FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes adenylyl cyclase 3 which is a membrane-associated enzyme and catalyzes the formation of the secondary messenger cyclic adenosine monophosphate (cAMP). This protein appears to be widely expressed in various human tissues and may be involved in a number of physiological and pathophysiological metabolic processes. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2016]
PHENOTYPE: Mice homozygous for one mutation of this gene display impaired olfaction and disorganization of glomeruli in the main olfactory bulb. Mutant animals also appear to be sterile as homozygous matings failed to produce litters. Mice with another mutant allele fail to survive beyond weaning. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted(4) Gene trapped(5)

Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
AI314180 T A 4: 58,809,401 K1658* probably null Het
Aldh4a1 T C 4: 139,633,922 M60T probably benign Het
Alpk2 A T 18: 65,372,738 H70Q probably damaging Het
Babam2 T A 5: 31,701,863 I5N possibly damaging Het
Blm T C 7: 80,513,229 T125A probably benign Het
Bloc1s1 T C 10: 128,923,957 probably benign Het
Calcr G T 6: 3,714,651 Q160K probably benign Het
Ccdc43 C T 11: 102,690,232 A131T probably damaging Het
Cdh15 A T 8: 122,865,100 N575Y probably damaging Het
Chd8 T C 14: 52,204,154 D827G probably damaging Het
Col3a1 A G 1: 45,347,899 probably null Het
Creb5 A T 6: 53,681,017 M255L possibly damaging Het
Cst8 A G 2: 148,804,583 I78V probably benign Het
Cyld A G 8: 88,733,036 E440G possibly damaging Het
Cyp2b9 A C 7: 26,187,742 D192A probably damaging Het
Dclre1b C T 3: 103,803,974 R207H probably damaging Het
Dnah6 A T 6: 73,123,855 F1936L probably damaging Het
Dpp9 A C 17: 56,189,424 Y761* probably null Het
Drc1 A T 5: 30,356,401 M434L probably benign Het
Dtx3l A T 16: 35,933,027 I403N probably damaging Het
Efcab9 A G 11: 32,527,484 Y13H probably damaging Het
Efhb T A 17: 53,401,626 N672I possibly damaging Het
Eif5b T C 1: 38,045,754 V894A possibly damaging Het
Elovl3 T C 19: 46,134,696 F237S probably benign Het
Emc1 T A 4: 139,366,491 D637E probably damaging Het
Erbb2 C A 11: 98,433,412 P742Q probably damaging Het
Fam234b C A 6: 135,233,357 L584M probably damaging Het
Fancd2 A T 6: 113,568,712 D14V possibly damaging Het
Fat2 T C 11: 55,262,820 H3522R probably benign Het
Fgfr2 T C 7: 130,241,215 N147D possibly damaging Het
Gm26657 A G 4: 56,741,180 probably benign Het
Hcrtr1 C T 4: 130,135,725 V188M probably benign Het
Herc1 T C 9: 66,467,887 V3331A probably damaging Het
Hmcn2 T C 2: 31,430,441 V3978A possibly damaging Het
Invs G A 4: 48,385,262 R202K probably benign Het
Lgr5 C T 10: 115,478,564 S156N probably benign Het
Mras T G 9: 99,394,616 D67A probably damaging Het
Mrpl39 A G 16: 84,723,902 L283P probably damaging Het
Ncoa6 A T 2: 155,433,995 I110N probably benign Het
Neb T C 2: 52,212,584 D544G possibly damaging Het
Nlrc3 A G 16: 3,964,753 I264T possibly damaging Het
Olfr180 T C 16: 58,915,885 Y252C possibly damaging Het
Olfr341 A G 2: 36,479,297 Y278H probably damaging Het
Olfr714 T A 7: 107,073,873 M15K probably benign Het
Olfr830 A G 9: 18,876,146 K273R probably benign Het
Otx1 C A 11: 21,997,037 A91S probably damaging Het
Phf11d T C 14: 59,352,671 D234G probably null Het
Polq A T 16: 37,082,784 D1980V probably damaging Het
Rasa1 A T 13: 85,288,903 probably benign Het
Rufy4 T C 1: 74,147,663 C537R probably damaging Het
Sec23a A G 12: 59,007,005 V69A probably benign Het
Sipa1 A G 19: 5,659,612 I260T probably damaging Het
Smarcc1 T A 9: 110,190,949 L628H probably damaging Het
Snx31 A G 15: 36,525,584 V323A probably damaging Het
Sun2 A G 15: 79,727,522 S565P probably damaging Het
Tmem74 C T 15: 43,867,168 D160N possibly damaging Het
Tnik T C 3: 28,594,092 M431T probably benign Het
Trp53inp1 A G 4: 11,165,305 T110A probably benign Het
Ttll9 G T 2: 152,984,224 C118F probably benign Het
Vps4b A G 1: 106,791,692 L42P probably benign Het
Xirp2 A T 2: 67,511,906 N1497I probably damaging Het
Xpo4 A G 14: 57,638,307 V123A probably damaging Het
Zfhx4 A T 3: 5,412,425 T3367S probably damaging Het
Zfp236 T C 18: 82,597,688 E1782G possibly damaging Het
Zfp35 T A 18: 24,002,916 C106S possibly damaging Het
Zfpm1 A G 8: 122,336,073 T624A probably benign Het
Zmiz2 C T 11: 6,397,519 Q276* probably null Het
Other mutations in Adcy3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Adcy3 APN 12 4194357 missense probably damaging 1.00
IGL00985:Adcy3 APN 12 4134600 missense probably damaging 0.98
IGL01735:Adcy3 APN 12 4201213 missense probably benign 0.00
IGL02097:Adcy3 APN 12 4212118 missense probably damaging 1.00
IGL02102:Adcy3 APN 12 4134699 missense probably damaging 1.00
IGL02103:Adcy3 APN 12 4134390 missense possibly damaging 0.69
IGL02155:Adcy3 APN 12 4212142 nonsense probably null
IGL02376:Adcy3 APN 12 4201031 missense possibly damaging 0.77
IGL02411:Adcy3 APN 12 4209407 unclassified probably null
IGL02465:Adcy3 APN 12 4200906 missense probably benign 0.10
IGL02819:Adcy3 APN 12 4206986 splice site probably benign
magnificent_frigatebird UTSW 12 4194324 missense
R0015:Adcy3 UTSW 12 4195260 critical splice donor site probably null
R0015:Adcy3 UTSW 12 4195260 critical splice donor site probably null
R0918:Adcy3 UTSW 12 4198360 missense probably benign 0.05
R1480:Adcy3 UTSW 12 4212171 missense probably damaging 1.00
R1736:Adcy3 UTSW 12 4200998 missense possibly damaging 0.87
R1885:Adcy3 UTSW 12 4134951 missense probably damaging 1.00
R1897:Adcy3 UTSW 12 4173450 splice site probably benign
R1951:Adcy3 UTSW 12 4208624 missense probably benign 0.29
R2083:Adcy3 UTSW 12 4173512 missense probably damaging 1.00
R2417:Adcy3 UTSW 12 4208627 missense probably benign 0.05
R4379:Adcy3 UTSW 12 4134558 missense probably damaging 1.00
R4785:Adcy3 UTSW 12 4206542 missense probably benign 0.00
R4960:Adcy3 UTSW 12 4134896 missense probably benign 0.11
R5001:Adcy3 UTSW 12 4198434 missense possibly damaging 0.56
R5166:Adcy3 UTSW 12 4134438 missense probably damaging 1.00
R5416:Adcy3 UTSW 12 4209308 missense probably damaging 1.00
R5998:Adcy3 UTSW 12 4198348 missense probably damaging 1.00
R6248:Adcy3 UTSW 12 4208662 critical splice donor site probably null
R6490:Adcy3 UTSW 12 4212150 missense probably damaging 1.00
R6566:Adcy3 UTSW 12 4194324 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCCTTAGAAACGGGCAAAC -3'
(R):5'- GAATCACACAGCAGGCTCCATG -3'

Sequencing Primer
(F):5'- CGGGCAAACTTGATAGTGCATTC -3'
(R):5'- AGCAGCAGGGAGACTCCAC -3'
Posted On2016-09-06